MirGeneDB

MirGeneDB ID

Isc-Mir-96-P2

Family name MIR-96 (all species)
Seed UUGGCAC
Species Deer tick (Ixodes scapularis)
MiRBase ID
Paralogues Isc-Mir-96-P1  Isc-Mir-96-P3 
Orthologues Aae-Mir-96-P2  Aca-Mir-96-P2  Ami-Mir-96-P2  Bfl-Mir-96-P2a  Bfl-Mir-96-P2b  Bfl-Mir-96-P2c  Bge-Mir-96-P2  Bta-Mir-96-P2  Cbr-Mir-96-P2f  Cbr-Mir-96-P2g  Cel-Mir-96-P2  Cfa-Mir-96-P2  Cgi-Mir-96-P2h  Cgi-Mir-96-P2i  Cin-Mir-96-P2  Cli-Mir-96-P2  Cpi-Mir-96-P2  Cpo-Mir-96-P2  Cte-Mir-96-P2  Dan-Mir-96-P2  Dme-Mir-96-P2  Dno-Mir-96-P2  Dpu-Mir-96-P2  Dre-Mir-96-P2  Efe-Mir-96-P2d  Efe-Mir-96-P2e  Ete-Mir-96-P2  Gga-Mir-96-P2  Hme-Mir-96-P2  Hsa-Mir-96-P2  Lan-Mir-96-P2  Lgi-Mir-96-P2  Mdo-Mir-96-P2  Mml-Mir-96-P2  Mmu-Mir-96-P2  Oan-Mir-96-P2  Ocu-Mir-96-P2  Pfl-Mir-96-P2  Pmi-Mir-96-P2  Rno-Mir-96-P2  Sha-Mir-96-P2  Sko-Mir-96-P2  Spu-Mir-96-P2  Sto-Mir-96-P2  Tca-Mir-96-P2  Xtr-Mir-96-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
DS633978: 112831-112895 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UGCCACGCUCGCAAGGCAACCGCUGUCGCCCUUGGCACUGAAAGAAUUCACAGAUGCUGCCCCUUUAAAACUCGUGGGUUCUCAAGUGCCAAAGAUGACGGUGCGUUCGGAAGAACGGGAUCGUG
Get precursor sequence
Structure
        10         20         30        40        50         60  
UGCCACGCUCGCAAGGC-   -|       CCC        GAA         -  AUGCUGCC 
                  AAC CGCUGUCG   UUGGCACU   AGAAUUCAC AG        \
                  UUG GUGGCAGU   AACCGUGA   UCUUGGGUG UC        C
GUGCUAGGGCAAGAAGGC   C^       AGA        AC-         C  AAAAUUUC 
   120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Mir-96-P2_5p

MirBase accessionNone
Sequence
0- CUUGGCACUGAAAGAAUUCACAG -23
Get sequence
Star sequence

Isc-Mir-96-P2_3p* (predicted)

MirBase accessionNone
Sequence
43- GUGGGUUCUCAAGUGCCAAAGA -65
Get sequence