MirGeneDB

MirGeneDB ID

Cpi-Mir-96-P2

Family name MIR-96 (all species)
Seed UUGGCAA
Species Western painted turtle (Chrysemys picta bellii)
MiRBase ID cpi-mir-182
Paralogues Cpi-Mir-96-P1  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2 
Orthologues Aae-Mir-96-P2  Aca-Mir-96-P2  Ami-Mir-96-P2  Bfl-Mir-96-P2a  Bfl-Mir-96-P2b  Bfl-Mir-96-P2c  Bge-Mir-96-P2  Bta-Mir-96-P2  Cbr-Mir-96-P2f  Cbr-Mir-96-P2g  Cel-Mir-96-P2  Cfa-Mir-96-P2  Cgi-Mir-96-P2h  Cgi-Mir-96-P2i  Cin-Mir-96-P2  Cli-Mir-96-P2  Cpo-Mir-96-P2  Cte-Mir-96-P2  Dan-Mir-96-P2  Dme-Mir-96-P2  Dno-Mir-96-P2  Dpu-Mir-96-P2  Dre-Mir-96-P2  Efe-Mir-96-P2d  Efe-Mir-96-P2e  Ete-Mir-96-P2  Gga-Mir-96-P2  Hme-Mir-96-P2  Hsa-Mir-96-P2  Isc-Mir-96-P2  Lan-Mir-96-P2  Lgi-Mir-96-P2  Mdo-Mir-96-P2  Mml-Mir-96-P2  Mmu-Mir-96-P2  Oan-Mir-96-P2  Ocu-Mir-96-P2  Pfl-Mir-96-P2  Pmi-Mir-96-P2  Rno-Mir-96-P2  Sha-Mir-96-P2  Sko-Mir-96-P2  Spu-Mir-96-P2  Sto-Mir-96-P2  Tca-Mir-96-P2  Xtr-Mir-96-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(chrPic1)
JH584440: 1644025-1644089 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GUGGCUGCGUGCAUGGUCUCUCUCGCUGUCUUUGGCAAUGGUAGAACUCACACUGGUGAGGUAUCAGGAUCCGGUGGUUCUAGACUUGCCAACUACCGCCCGAGGGUACAGCCGGCGGCACCAGG
Get precursor sequence
Structure
        10          20        30        40        50        60  
GUGGCUGCGUGCAUGGU--|    UC  U  CU       UGG      U   ACUGGUGAGG 
                   CUCUC  GC GU  UUGGCAA   UAGAAC CAC          U
                   GGGAG  CG CA  AACCGUU   AUCUUG GUG          A
GGACCACGGCGGCCGACAU^    CC  C  UC       CAG      -   GCCUAGGACU 
   120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Te Te Te To
Mature sequence

Cpi-Mir-96-P2_5p

MirBase accessionMIMAT0037798
Sequence
0- UUUGGCAAUGGUAGAACUCACACU -24
Get sequence
Star sequence

Cpi-Mir-96-P2_3p*

MirBase accessionMIMAT0037799
Sequence
44- UGGUUCUAGACUUGCCAACUA -65
Get sequence