MirGeneDB

MirGeneDB ID

Cpi-Mir-96-P3-v2

Family name MIR-96 (all species)
Seed UGGCACU
Species Western painted turtle (Chrysemys picta bellii)
MiRBase ID cpi-mir-183
Paralogues Cpi-Mir-96-P1  Cpi-Mir-96-P2  Cpi-Mir-96-P3-v1 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(chrPic1)
JH584440: 1633084-1633143 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-96-P3-v2)
Mir-96-P3-v1 JH584440: 1633083-1633144 [+] UCSC
Mir-96-P3-v2 JH584440: 1633084-1633143 [+] UCSC
Mir-96-P1 JH584440: 1633482-1633545 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GCUGGGGCGAGCGUUACUCCUGUUCUGUGUAUGGCACUGGUAGAAUUCACUGUGAAAACACACUAUCAGUGAAUUACCAUAGGGCCAUAAACAGAGCAGAGAAAGAACCACAAGACCCAC
Get precursor sequence
Structure
        10          20        30          40        50         
GCUGGGGCGAGCGUUAC-  -         G      AC--|    GA        UGAAAA 
                  UC CUGUUCUGU UAUGGC    UGGUA  AUUCACUG      C
                  AG GACGAGACA AUACCG    ACCAU  UAAGUGAC      A
CACCCAGAACACCAAGAA  A         A      GGAU^    --        UAUCAC 
.       110       100        90        80          70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Te Te Te To
Mature sequence

Cpi-Mir-96-P3-v2_5p

MirBase accessionMIMAT0037800
Sequence
0- AUGGCACUGGUAGAAUUCACUG -22
Get sequence
Star sequence

Cpi-Mir-96-P3-v2_3p*

MirBase accessionNone
Sequence
38- GUGAAUUACCAUAGGGCCAUAA -60
Get sequence