MirGeneDB

MirGeneDB ID

Bfl-Mir-96-P3

Family name MIR-96 (all species)
Seed AUGGCAC
Species Florida lancelet (Branchiostoma floridae)
MiRBase ID bfl-mir-183
Paralogues Bfl-Mir-96-P1  Bfl-Mir-96-P2a  Bfl-Mir-96-P2b  Bfl-Mir-96-P2c 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(BFL_v2.0)
Bf_V2_186: 1108737-1108795 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-96-P3)
Mir-96-P3 Bf_V2_186: 1108737-1108795 [+] UCSC
Mir-96-P1 Bf_V2_186: 1109818-1109877 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CUCGGCGUUUCCACGUGCCCGUUCACGGUCUAUGGCACUGGUAGAAUUCACUGAUCGUAGACACCAGUGAUUCUUCAGUCAGCCAUACACCGUGGCGGGAAACUGAUCAUCGGACGCCA
Get precursor sequence
Structure
        10           20        30          40        50         
CUCGGCGUUUCCACGUG---    U       C      --|    U     U    GAUCGU 
                    CCCG UCACGGU UAUGGC  ACUGG AGAAU CACU      \
                    GGGC GGUGCCA AUACCG  UGACU UCUUA GUGA      A
ACCGCAGGCUACUAGUCAAA    -       C      AC^    -     -    CCACAG 
       110       100         90        80         70         60
Deep sequencing
Go to detailed chart
CommentThere is variation in the Dicer cut with sites +1 and +2 relative to what is shown here.
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Bfl-Mir-96-P3_5p

MirBase accessionMIMAT0009487
Sequence
0- UAUGGCACUGGUAGAAUUCACU -22
Get sequence
Co-mature sequence

Bfl-Mir-96-P3_3p

MirBase accessionNone
Sequence
37- UGAUUCUUCAGUCAGCCAUACA -59
Get sequence