
MirGeneDB ID


Family name MIR-96 (all species)
Species Human (Homo sapiens)
MiRBase ID hsa-mir-183
Paralogues Hsa-Mir-96-P1  Hsa-Mir-96-P2  Hsa-Mir-96-P3-v2 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
chr7: 129774927-129774988 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P3-v1)
Mir-96-P2 chr7: 129770406-129770470 [-] UCSC Ensembl
Mir-96-P1 chr7: 129774698-129774761 [-] UCSC Ensembl
Mir-96-P3-v1 chr7: 129774927-129774988 [-] UCSC Ensembl
Mir-96-P3-v2 chr7: 129774928-129774987 [-] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30          40        50        60
CAGGCCGCAGAGUGUGA---  C         G      AC--|    GA       GUGAACA 
                    CU CUGUUCUGU UAUGGC    UGGUA  AUUCACU       G
                    GA GACGAGACA AUACCG    GCCAU  UAAGUGA       U
CCUCCGGGAGCACCUAGACA  -         A      GGAA^    --       CUGACUC 
120       110        100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence


MirBase accessionMIMAT0000261
Get sequence
Validated targets microrna.org: MIMAT0000261
TargetScanVert: hsa-miR-183-5p.1
TargetMiner: hsa-miR-183-5p
miRDB: MIMAT0000261
Star sequence


MirBase accessionMIMAT0004560
Get sequence
Validated targets microrna.org: MIMAT0004560
TargetScanVert: hsa-miR-183-3p
TargetMiner: hsa-miR-183-3p
miRDB: MIMAT0004560