MirGeneDB

MirGeneDB ID

Aae-Mir-96-P3

Family name MIR-96 (all species)
Seed AUGGCAC
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-263a
Paralogues Aae-Mir-96-P2 
Orthologues Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Aaeg_L3)
supercont1.981: 164960-165021 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GCUCCUCCGUUUUUGGCUCCUAGUACACGUAAUGGCACUGGAAGAAUUCACGGGUAUAUUUUGAAAUCCCCGUGUUCUGGCAGUGGCAUCCCUGGUACUAAGGUGAUUCAUCAGUUUCGGUG
Get precursor sequence
Structure
        10         20         30        40        50        60 
GCUCCUCCGUUUUUGGCU-  -|     ACGUA   G     GA    UU      UAUAUU 
                   CC UAGUAC     AUG CACUG  AGAA  CACGGG      U
                   GG AUCAUG     UAC GUGAC  UCUU  GUGCCC      U
GUGGCUUUGACUACUUAGU  A^     GUCCC   G     GG    --      CUAAAG 
120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe To To To
Mature sequence

Aae-Mir-96-P3_5p

MirBase accessionMIMAT0014289
Sequence
0- AAUGGCACUGGAAGAAUUCACGGG -24
Get sequence
Star sequence

Aae-Mir-96-P3_3p*

MirBase accessionMIMAT0015372
Sequence
40- CGUGUUCUGGCAGUGGCAUCCC -62
Get sequence