MirGeneDB

MirGeneDB ID

Gga-Mir-96-P3-v1

Family name MIR-96 (all species)
Seed AUGGCAC
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-183
Paralogues Gga-Mir-96-P1  Gga-Mir-96-P2  Gga-Mir-96-P3-v2 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(galGal5)
1: 844384-844445 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P3-v1)
Mir-96-P2 1: 843242-843306 [-] UCSC Ensembl
Mir-96-P1 1: 844266-844329 [-] UCSC Ensembl
Mir-96-P3-v1 1: 844384-844445 [-] UCSC Ensembl
Mir-96-P3-v2 1: 844385-844444 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGGUGCGAGCUCGCUACUCCUGUUCUGUGUAUGGCACUGGUAGAAUUCACUGUGCAACCCCGCGGUCAGUGAAUUACCAUAGGGCCAUAAACAGAGCAGAGAAAGACCCGCGAGCCCCGCG
Get precursor sequence
Structure
        10           20        30          40        50        60
AGGGUGCGAGCUCGCUA---  C         G      AC--|    GA       GUGCAAC 
                    CU CUGUUCUGU UAUGGC    UGGUA  AUUCACU       C
                    GA GACGAGACA AUACCG    ACCAU  UAAGUGA       C
GCGCCCCGAGCGCCCAGAAA  -         A      GGAU^    --       CUGGCGC 
120       110        100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence

Gga-Mir-96-P3-v1_5p

MirBase accessionMIMAT0001191
Sequence
0- UAUGGCACUGGUAGAAUUCACU -22
Get sequence
Validated targets TargetScanVert: gga-miR-183
miRDB: MIMAT0001191
Star sequence

Gga-Mir-96-P3-v1_3p*

MirBase accessionNone
Sequence
40- UGAAUUACCAUAGGGCCAUAAA -62
Get sequence