MirGeneDB

MirGeneDB ID

Cel-Mir-96-P3

Family name MIR-96 (all species)
Seed AUGGCAC
Species Roundworm (Caenorhabditis elegans)
MiRBase ID cel-mir-228
Paralogues Cel-Mir-96-P2 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ce11)
chrIV: 5562040-5562103 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P3)
Mir-96-P3 chrIV: 5562040-5562103 [+] UCSC Ensembl
Mir-96-P2 chrIV: 5566427-5566488 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCGAGACAUUUUCCUCCUUAUCCCGUUCGCAAUGGCACUGCAUGAAUUCACGGCUAUGCAUAACGACAGACCGCGGAUCAUACGGUACCAUAGCGGACGGUGAUGAGGUUAAUGAAGUAGUGAG
Get precursor sequence
Structure
        10         20         30        40        50        60  
GCGAGACAUUUUCCUCC-     -|       A    C    C    A   A   CUAUGCAU 
                  UUAUC CCGUUCGC AUGG ACUG AUGA UUC CGG        \
                  AGUAG GGCAGGCG UACC UGGC UACU AGG GCC        A
GAGUGAUGAAGUAAUUGG     U^       A    A    A    -   C   AGACAGCA 
  120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Wt Da Ea Mi Yo Yo
Mature sequence

Cel-Mir-96-P3_5p

MirBase accessionMIMAT0000283
Sequence
0- AAUGGCACUGCAUGAAUUCACGG -23
Get sequence
Validated targets microrna.org: MIMAT0000283
TargetScanWorm: cel-miR-228
Star sequence

Cel-Mir-96-P3_3p*

MirBase accessionMIMAT0020327
Sequence
42- GCGGAUCAUACGGUACCAUAGC -64
Get sequence