MirGeneDB

MirGeneDB ID

Cli-Mir-96-P3-v1

Family name MIR-96 (all species)
Seed AUGGCAC
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-183
Paralogues Cli-Mir-96-P1  Cli-Mir-96-P2  Cli-Mir-96-P3-v2 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold121: 1261591-1261652 [+]
Clustered MiRNAs
(< 10kb from Mir-96-P3-v1)
Mir-96-P3-v1 scaffold121: 1261591-1261652 [+]
Mir-96-P3-v2 scaffold121: 1261592-1261651 [+]
Mir-96-P1 scaffold121: 1261712-1261775 [+]
Mir-96-P2 scaffold121: 1262259-1262323 [+]
Precursor
(pre-Mir +30nt flank)
CAGGUGCGAGCUCGCUACUCCUGUUCUGUGUAUGGCACUGGUAGAAUUCACUGUGCAACCCCGCGGUCAGUGAAUUACCAUAGGGCCAUAAACAGAGCAGAGAAAGGCCCGCGAGCCCCGGC
Get precursor sequence
Structure
        10           20        30          40        50        60
CAGGUGCGAGCUCGCUA---  C         G      AC--|    GA       GUGCAAC 
                    CU CUGUUCUGU UAUGGC    UGGUA  AUUCACU       C
                    GA GACGAGACA AUACCG    ACCAU  UAAGUGA       C
CGGCCCCGAGCGCCCGGAAA  -         A      GGAU^    --       CUGGCGC 
120       110        100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Cli-Mir-96-P3-v1_5p

MirBase accessionMIMAT0038558
Sequence
0- UAUGGCACUGGUAGAAUUCACU -22
Get sequence
Star sequence

Cli-Mir-96-P3-v1_3p*

MirBase accessionMIMAT0038559
Sequence
40- UGAAUUACCAUAGGGCCAUAAA -62
Get sequence