MirGeneDB

MirGeneDB ID

Sto-Mir-96-P3-v1

Family name MIR-96 (all species)
Seed AUGGCAC
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-96-P1  Sto-Mir-96-P2  Sto-Mir-96-P3-v2 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01006258.1: 22496-22557 [-]
Precursor
(pre-Mir +30nt flank)
GCUUGGGGUGACUCUGACUCCUGUUCUGUGUAUGGCACUGGUAGAAUUCACUGUGACAACACACAAUCAGUGAAUUACCAUAGGGCCAUAAACAGAGCAGAGAAAUAACCAAUAUGCCACAA
Get precursor sequence
Structure
        10           20        30          40        50        60
GCUUGGGGUGACUCUGA---  C         G      AC--|    GA       GUGACAA 
                    CU CUGUUCUGU UAUGGC    UGGUA  AUUCACU       C
                    GA GACGAGACA AUACCG    ACCAU  UAAGUGA       A
AACACCGUAUAACCAAUAAA  -         A      GGAU^    --       CUAACAC 
120       110        100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Mature sequence

Sto-Mir-96-P3-v1_5p

MirBase accessionNone
Sequence
0- UAUGGCACUGGUAGAAUUCACU -22
Get sequence
Star sequence

Sto-Mir-96-P3-v1_3p*

MirBase accessionNone
Sequence
40- UGAAUUACCAUAGGGCCAUAAA -62
Get sequence