MirGeneDB

MirGeneDB ID

Sko-Mir-96-P3

Family name MIR-96 (all species)
Seed AUGGCAC
Species Saccoglossus (Saccoglossus kowalevskii)
MiRBase ID sko-mir-183
Paralogues Sko-Mir-96-P1  Sko-Mir-96-P2 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Skow_1.1)
NW_003114962.1: 34337-34398 [+]
Clustered MiRNAs
(< 10kb from Mir-96-P3)
Mir-96-P3 NW_003114962.1: 34337-34398 [+]
Mir-96-P1 NW_003114962.1: 36626-36685 [+]
Mir-96-P2 NW_003114962.1: 37045-37105 [+]
Precursor
(pre-Mir +30nt flank)
UGUGCUUUCACAUUACCACUUUGCGCUGUGAAUGGCACUGUAUGAAUUCACUGCACUCUGAUCGCUUCCAGUGGAUUUUCCAGUGCCAUUUACAACGUCAAGAAUUAAAUCGCAUAUCAAUC
Get precursor sequence
Structure
        10          20        30        40        50        60 
UGUGCUUUCACAUUACCA--|  U   C              UAU          CACUCUG 
                    CUU GCG UGUGAAUGGCACUG   GAAUUCACUG       \
                    GAA UGC ACAUUUACCGUGAC   UUUAGGUGAC       A
CUAACUAUACGCUAAAUUAA^  C   A              CU-          CUUCGCU 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Mature sequence

Sko-Mir-96-P3_5p

MirBase accessionMIMAT0009631
Sequence
0- AAUGGCACUGUAUGAAUUCACUG -23
Get sequence
Star sequence

Sko-Mir-96-P3_3p* (predicted)

MirBase accessionNone
Sequence
40- GUGGAUUUUCCAGUGCCAUUUA -62
Get sequence