MirGeneDB

MirGeneDB ID

Cpo-Mir-96-P3-v1

Family name MIR-96 (all species)
Seed AUGGCAC
Species Guinea pig (Cavia porcellus)
MiRBase ID cpo-mir-183
Paralogues Cpo-Mir-96-P1  Cpo-Mir-96-P2  Cpo-Mir-96-P3-v2 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(cavPor3)
scaffold_11: 50142394-50142455 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-96-P3-v1)
Mir-96-P2 scaffold_11: 50138735-50138799 [-] UCSC
Mir-96-P1 scaffold_11: 50142184-50142247 [-] UCSC
Mir-96-P3-v1 scaffold_11: 50142394-50142455 [-] UCSC
Mir-96-P3-v2 scaffold_11: 50142395-50142454 [-] UCSC
Precursor
(pre-Mir +30nt flank)
CAGUCCGGAGAGCAUAACUCCUGUUCUGUGUAUGGCACUGGUAGAAUUCACUGUGAACAGUCUCAGUCAGUGAAUUACCGAAGGGCCAUAAACAGAGCAGAGACAGAUCCGCGAGCGCCUUG
Get precursor sequence
Structure
        10           20        30          40        50        60
CAGUCCGGAGAGCAUAA---  C         G      AC--|    GA       GUGAACA 
                    CU CUGUUCUGU UAUGGC    UGGUA  AUUCACU       G
                    GA GACGAGACA AUACCG    GCCAU  UAAGUGA       U
GUUCCGCGAGCGCCUAGACA  -         A      GGAA^    --       CUGACUC 
120       110        100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Cpo-Mir-96-P3-v1_5p

MirBase accessionMIMAT0047050
Sequence
0- UAUGGCACUGGUAGAAUUCACU -22
Get sequence
Star sequence

Cpo-Mir-96-P3-v1_3p*

MirBase accessionMIMAT0047051
Sequence
40- UGAAUUACCGAAGGGCCAUAAA -62
Get sequence