MirGeneDB

MirGeneDB ID

Cbr-Mir-96-P3

Family name MIR-96 (all species)
Seed AUGGCAC
Species Roundworm (Caenorhabditis briggsae)
MiRBase ID cbr-mir-228
Paralogues Cbr-Mir-96-P2f  Cbr-Mir-96-P2g 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(CB4)
IV: 6041106-6041167 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P3)
Mir-96-P3 IV: 6041106-6041167 [+] Ensembl
Mir-96-P2g IV: 6048235-6048292 [+] Ensembl
Mir-96-P2f IV: 6048856-6048920 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUAUACAUAAAGGAAUCCCACCCUGUUCGCAAUGGCACUGCAUGAAUUCACGGAUGCAAAGCGACAGACCGCGGAUCAUGCGGUACCAUAGCUGACGGUGGUGAGAUCAGAUUAUUUGAAUC
Get precursor sequence
Structure
        10         20         30        40        50        60 
AUAUACAUAAAGGAAUCC-    -|    C  A    C         A   A   AUGCAAA 
                   CACC CUGUU GC AUGG ACUGCAUGA UUC CGG       \
                   GUGG GGCAG CG UACC UGGCGUACU AGG GCC       G
CUAAGUUUAUUAGACUAGA    U^    U  A    A         -   C   AGACAGC 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 Cb Ea Ma Yo
Mature sequence

Cbr-Mir-96-P3_5p

MirBase accessionMIMAT0000495
Sequence
0- AAUGGCACUGCAUGAAUUCACGG -23
Get sequence
Star sequence

Cbr-Mir-96-P3_3p*

MirBase accessionNone
Sequence
40- GCGGAUCAUGCGGUACCAUAGC -62
Get sequence