MirGeneDB

MirGeneDB ID

Spu-Mir-96-P3

Family name MIR-96 (all species)
Seed AUGGCAC
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-183
Paralogues Spu-Mir-96-P1  Spu-Mir-96-P2 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold192: 529030-529097 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P3)
Mir-96-P3 Scaffold192: 529030-529097 [+] Ensembl
Mir-96-P1 Scaffold192: 530591-530664 [+] Ensembl
Mir-96-P2 Scaffold192: 534073-534139 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GCUUGACUUCAUUUAUCUCUGCUCCUCGUCUAUGGCACUAUAGAAUUCACUGUGUGUUGUGUUGCCAUGGUAACAGCUGGUUCUACAGUGCCAUUGCAUGAUGGGUAGAAACAUUCAUGUUUGUCAUU
Get precursor sequence
Structure
        10          20        30         40        50        60   
GCUUGACUUCAUUUAUC--       C    CU-|       A       CA   UGUGUUGUGU 
                   UCUGCUC UCGU   AUGGCACU UAGAAUU  CUG          \
                   AGAUGGG AGUA   UACCGUGA AUCUUGG  GAC          U
UUACUGUUUGUACUUACAA       U    CGU^       C       UC   AAUGGUACCG 
      120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Mir-96-P3_5p

MirBase accessionMIMAT0009684
Sequence
0- UAUGGCACUAUAGAAUUCACUG -22
Get sequence
Star sequence

Spu-Mir-96-P3_3p*

MirBase accessionNone
Sequence
45- GCUGGUUCUACAGUGCCAUUGCA -68
Get sequence