MirGeneDB

MirGeneDB ID

Spu-Mir-96-P1

Family name MIR-96 (all species)
Seed UUGGCAC
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-96
Paralogues Spu-Mir-96-P2  Spu-Mir-96-P3 
Orthologues Ami-Mir-96-P1  Bfl-Mir-96-P1  Bta-Mir-96-P1  Cfa-Mir-96-P1  Cgi-Mir-96-P1a  Cgi-Mir-96-P1b  Cin-Mir-96-P1  Cli-Mir-96-P1  Cpi-Mir-96-P1  Cpo-Mir-96-P1  Cte-Mir-96-P1  Dno-Mir-96-P1  Dre-Mir-96-P1  Efe-Mir-96-P1  Ete-Mir-96-P1  Gga-Mir-96-P1  Hsa-Mir-96-P1  Isc-Mir-96-P1  Lan-Mir-96-P1  Lgi-Mir-96-P1a  Lgi-Mir-96-P1b  Mdo-Mir-96-P1  Mml-Mir-96-P1  Mmu-Mir-96-P1  Oan-Mir-96-P1  Ocu-Mir-96-P1  Pfl-Mir-96-P1  Pmi-Mir-96-P1  Rno-Mir-96-P1  Sha-Mir-96-P1  Sko-Mir-96-P1  Sto-Mir-96-P1  Tgu-Mir-96-P1  Xtr-Mir-96-P1 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold192: 530591-530664 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P1)
Mir-96-P3 Scaffold192: 529030-529097 [+] Ensembl
Mir-96-P1 Scaffold192: 530591-530664 [+] Ensembl
Mir-96-P2 Scaffold192: 534073-534139 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CGCUCCUCUCCUCUACCCUAUACUAGUCUGUUUGGCACUAGCACAUUUUGCUGUACCUCGAAAGAGGCUCAUUGUCGUGUGCAAGAUAUGUUUGUGCCAAGCCAGAUUGGAGGGUGCAGCCAUCGAAUAAUACC
Get precursor sequence
Structure
        10        20           30        40        50        60      
CGCUCCUCUCCUCUACCCUAUA--       -|        U    C       UGUACCUCGAAAGA 
                        CUAGUCU GUUUGGCAC AGCA AUUUUGC              \
                        GGUUAGA CGAACCGUG UUGU UAGAACG              G
CCAUAAUAAGCUACCGACGUGGGA       C^        U    A       UGUGCUGUUACUCG 
  130       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Mir-96-P1_5p

MirBase accessionMIMAT0009665
Sequence
0- UUUGGCACUAGCACAUUUUGC -21
Get sequence
Star sequence

Spu-Mir-96-P1_3p*

MirBase accessionNone
Sequence
52- AAGAUAUGUUUGUGCCAAGCCA -74
Get sequence