MirGeneDB

MirGeneDB ID

Ete-Mir-96-P1

Family name MIR-96 (all species)
Seed UUGGCAC
Species Lesser hedgehog tenrec (Echinops telfairi)
MiRBase ID
Paralogues Ete-Mir-96-P2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2 
Orthologues Ami-Mir-96-P1  Bfl-Mir-96-P1  Bta-Mir-96-P1  Cfa-Mir-96-P1  Cgi-Mir-96-P1a  Cgi-Mir-96-P1b  Cin-Mir-96-P1  Cli-Mir-96-P1  Cpi-Mir-96-P1  Cpo-Mir-96-P1  Cte-Mir-96-P1  Dno-Mir-96-P1  Dre-Mir-96-P1  Efe-Mir-96-P1  Gga-Mir-96-P1  Hsa-Mir-96-P1  Isc-Mir-96-P1  Lan-Mir-96-P1  Lgi-Mir-96-P1a  Lgi-Mir-96-P1b  Mdo-Mir-96-P1  Mml-Mir-96-P1  Mmu-Mir-96-P1  Oan-Mir-96-P1  Ocu-Mir-96-P1  Pfl-Mir-96-P1  Pmi-Mir-96-P1  Rno-Mir-96-P1  Sha-Mir-96-P1  Sko-Mir-96-P1  Spu-Mir-96-P1  Sto-Mir-96-P1  Tgu-Mir-96-P1  Xtr-Mir-96-P1 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(echTel2)
JH980321: 22675133-22675196 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GGCCACACUGGCACCACCUGCUUGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCGCUCUGAGCAAUCAUGUGCAGUGCCAAUAUGGGAGAAGCGGGCAGAGCGUCAAGUCCCCC
Get precursor sequence
Structure
        10          20        30        40        50        60  
GGCCACACUGGCACCAC--|     GG  G  U        A      UU     UGUGUCUC 
                   CUGCUU  CC AU UUGGCACU GCACAU  UUGCU        \
                   GGCGAA  GG UA AACCGUGA CGUGUA  AACGA        U
CCCCCUGAACUGCGAGACG^     GA  G  U        -      CU     GUCUCGCC 
  120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Ete-Mir-96-P1_5p

MirBase accessionNone
Sequence
0- UUUGGCACUAGCACAUUUUUGCU -23
Get sequence
Star sequence

Ete-Mir-96-P1_3p*

MirBase accessionNone
Sequence
42- CAAUCAUGUGCAGUGCCAAUAU -64
Get sequence