MirGeneDB

MirGeneDB ID

Cli-Mir-96-P1

Family name MIR-96 (all species)
Seed UUGGCAC
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-96
Paralogues Cli-Mir-96-P2  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2 
Orthologues Ami-Mir-96-P1  Bfl-Mir-96-P1  Bta-Mir-96-P1  Cfa-Mir-96-P1  Cgi-Mir-96-P1a  Cgi-Mir-96-P1b  Cin-Mir-96-P1  Cpi-Mir-96-P1  Cpo-Mir-96-P1  Cte-Mir-96-P1  Dno-Mir-96-P1  Dre-Mir-96-P1  Efe-Mir-96-P1  Ete-Mir-96-P1  Gga-Mir-96-P1  Hsa-Mir-96-P1  Isc-Mir-96-P1  Lan-Mir-96-P1  Lgi-Mir-96-P1a  Lgi-Mir-96-P1b  Mdo-Mir-96-P1  Mml-Mir-96-P1  Mmu-Mir-96-P1  Oan-Mir-96-P1  Ocu-Mir-96-P1  Pfl-Mir-96-P1  Pmi-Mir-96-P1  Rno-Mir-96-P1  Sha-Mir-96-P1  Sko-Mir-96-P1  Spu-Mir-96-P1  Sto-Mir-96-P1  Tgu-Mir-96-P1  Xtr-Mir-96-P1 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold121: 1261712-1261775 [+]
Clustered MiRNAs
(< 10kb from Mir-96-P1)
Mir-96-P3-v1 scaffold121: 1261591-1261652 [+]
Mir-96-P3-v2 scaffold121: 1261592-1261651 [+]
Mir-96-P1 scaffold121: 1261712-1261775 [+]
Mir-96-P2 scaffold121: 1262259-1262323 [+]
Precursor
(pre-Mir +30nt flank)
CGGGGCCGUCGCCGACGCCGCCCGGCCCGUUUUGGCACUAGCACAUUUUUGCUUUGAUUUGUAGCUUUUGAGCAAUUAUGUGUAGUGCCAAUAUGGGAGAAGGCGGAGAGAGCAGCGCCGGGGU
Get precursor sequence
Structure
        10         20         30        40        50        60  
CGGGGCCGUCGCCGACG-     CGG-|    U         G     UU     UUGAUUUG 
                  CCGCC    CCCGU UUGGCACUA CACAU  UUGCU        \
                  GGCGG    GGGUA AACCGUGAU GUGUA  AACGA        U
UGGGGCCGCGACGAGAGA     AAGA^    U         -     UU     GUUUUCGA 
  120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Cli-Mir-96-P1_5p

MirBase accessionMIMAT0038476
Sequence
0- UUUGGCACUAGCACAUUUUUGCU -23
Get sequence
Star sequence

Cli-Mir-96-P1_3p*

MirBase accessionMIMAT0038477
Sequence
42- CAAUUAUGUGUAGUGCCAAUAU -64
Get sequence