MirGeneDB

MirGeneDB ID

Cli-Mir-96-P2

Family name MIR-96 (all species)
Seed UUGGCAA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-182
Paralogues Cli-Mir-96-P1  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2 
Orthologues Aae-Mir-96-P2  Aca-Mir-96-P2  Ami-Mir-96-P2  Bfl-Mir-96-P2a  Bfl-Mir-96-P2b  Bfl-Mir-96-P2c  Bge-Mir-96-P2  Bta-Mir-96-P2  Cbr-Mir-96-P2f  Cbr-Mir-96-P2g  Cel-Mir-96-P2  Cfa-Mir-96-P2  Cgi-Mir-96-P2h  Cgi-Mir-96-P2i  Cin-Mir-96-P2  Cpi-Mir-96-P2  Cpo-Mir-96-P2  Cte-Mir-96-P2  Dan-Mir-96-P2  Dme-Mir-96-P2  Dno-Mir-96-P2  Dpu-Mir-96-P2  Dre-Mir-96-P2  Efe-Mir-96-P2d  Efe-Mir-96-P2e  Ete-Mir-96-P2  Gga-Mir-96-P2  Hme-Mir-96-P2  Hsa-Mir-96-P2  Isc-Mir-96-P2  Lan-Mir-96-P2  Lgi-Mir-96-P2  Mdo-Mir-96-P2  Mml-Mir-96-P2  Mmu-Mir-96-P2  Oan-Mir-96-P2  Ocu-Mir-96-P2  Pfl-Mir-96-P2  Pmi-Mir-96-P2  Rno-Mir-96-P2  Sha-Mir-96-P2  Sko-Mir-96-P2  Spu-Mir-96-P2  Sto-Mir-96-P2  Tca-Mir-96-P2  Xtr-Mir-96-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold121: 1262259-1262323 [+]
Clustered MiRNAs
(< 10kb from Mir-96-P2)
Mir-96-P3-v1 scaffold121: 1261591-1261652 [+]
Mir-96-P3-v2 scaffold121: 1261592-1261651 [+]
Mir-96-P1 scaffold121: 1261712-1261775 [+]
Mir-96-P2 scaffold121: 1262259-1262323 [+]
Precursor
(pre-Mir +30nt flank)
GGCUGAGCUGCUCCCGGCCCCGGGGCUGCUUUUGGCAAUGGUAGAACUCACACUGGUGCGGUAGCAGGAUCCGGUGGUUCUAGACUUGCCAACUACAGCCCCGGGGGAGCGCUGCGGAUUCGGGG
Get precursor sequence
Structure
        10          20        30        40        50        60  
GGCUGAGCUGCUCCCGG--|          CUU       UGG      U   ACUGGUGCGG 
                   CCCCGGGGCUG   UUGGCAA   UAGAAC CAC          U
                   GGGGCCCCGAC   AACCGUU   AUCUUG GUG          A
GGGGCUUAGGCGUCGCGAG^          AUC       CAG      -   GCCUAGGACG 
   120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-96-P2_5p

MirBase accessionMIMAT0038556
Sequence
0- UUUGGCAAUGGUAGAACUCACACU -24
Get sequence
Star sequence

Cli-Mir-96-P2_3p*

MirBase accessionMIMAT0038557
Sequence
44- UGGUUCUAGACUUGCCAACUA -65
Get sequence