MirGeneDB

MirGeneDB ID

Bta-Mir-96-P2

Family name MIR-96 (all species)
Seed UUGGCAA
Species Cow (Bos taurus)
MiRBase ID bta-mir-182
Paralogues Bta-Mir-96-P1  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2 
Orthologues Aae-Mir-96-P2  Aca-Mir-96-P2  Ami-Mir-96-P2  Bfl-Mir-96-P2a  Bfl-Mir-96-P2b  Bfl-Mir-96-P2c  Bge-Mir-96-P2  Cbr-Mir-96-P2f  Cbr-Mir-96-P2g  Cel-Mir-96-P2  Cfa-Mir-96-P2  Cgi-Mir-96-P2h  Cgi-Mir-96-P2i  Cin-Mir-96-P2  Cli-Mir-96-P2  Cpi-Mir-96-P2  Cpo-Mir-96-P2  Cte-Mir-96-P2  Dan-Mir-96-P2  Dme-Mir-96-P2  Dno-Mir-96-P2  Dpu-Mir-96-P2  Dre-Mir-96-P2  Efe-Mir-96-P2d  Efe-Mir-96-P2e  Ete-Mir-96-P2  Gga-Mir-96-P2  Hme-Mir-96-P2  Hsa-Mir-96-P2  Isc-Mir-96-P2  Lan-Mir-96-P2  Lgi-Mir-96-P2  Mdo-Mir-96-P2  Mml-Mir-96-P2  Mmu-Mir-96-P2  Oan-Mir-96-P2  Ocu-Mir-96-P2  Pfl-Mir-96-P2  Pmi-Mir-96-P2  Rno-Mir-96-P2  Sha-Mir-96-P2  Sko-Mir-96-P2  Spu-Mir-96-P2  Sto-Mir-96-P2  Tca-Mir-96-P2  Xtr-Mir-96-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr4: 94406722-94406786 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P2)
Mir-96-P2 chr4: 94406722-94406786 [-] UCSC Ensembl
Mir-96-P1 chr4: 94411209-94411272 [-] UCSC Ensembl
Mir-96-P3-v1 chr4: 94411434-94411495 [-] UCSC Ensembl
Mir-96-P3-v2 chr4: 94411435-94411494 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUCUGCCGCCGCCGCCUGCCUCCCACCAUUUUUGGCAAUGGUAGAACUCACACUGGUGAGGUAAUGGGAUCCGGUGGUUCUAGACUUGCCAACUAUGGUGCGAGGGCUUGGCCAGCAACUCCGCC
Get precursor sequence
Structure
        10          20        30        40        50        60  
GUCUGCCGCCGCCGCCUG--|   C      UU       UGG      U   ACUGGUGAGG 
                    CCUC CACCAU  UUGGCAA   UAGAAC CAC          U
                    GGAG GUGGUA  AACCGUU   AUCUUG GUG          A
CCGCCUCAACGACCGGUUCG^   C      UC       CAG      -   GCCUAGGGUA 
   120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-96-P2_5p

MirBase accessionMIMAT0009244
Sequence
0- UUUGGCAAUGGUAGAACUCACACU -24
Get sequence
Validated targets TargetScanVert: bta-miR-182
Star sequence

Bta-Mir-96-P2_3p* (predicted)

MirBase accessionNone
Sequence
44- UGGUUCUAGACUUGCCAACUA -65
Get sequence