
MirGeneDB ID


Family name MIR-96 (all species)
Species Cow (Bos taurus)
MiRBase ID bta-mir-183
Paralogues Bta-Mir-96-P1  Bta-Mir-96-P2  Bta-Mir-96-P3-v2 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
chr4: 94411434-94411495 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P3-v1)
Mir-96-P2 chr4: 94406722-94406786 [-] UCSC Ensembl
Mir-96-P1 chr4: 94411209-94411272 [-] UCSC Ensembl
Mir-96-P3-v1 chr4: 94411434-94411495 [-] UCSC Ensembl
Mir-96-P3-v2 chr4: 94411435-94411494 [-] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30          40        50        60
GAGGCCAGAGAGCGUGA---  C         G      AC--|    GA       GUGAACA 
                    CU CUGUUCUGU UAUGGC    UGGUA  AUUCACU       G
                    GA GACGAGACA AUACCG    GCCAU  UAAGUGA       U
ACUCUGUGAGCGCCUAGACA  -         A      GGAA^    --       CUGGCUC 
120       110        100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence


MirBase accessionMIMAT0009245
Get sequence
Validated targets TargetScanVert: bta-miR-183
Star sequence


MirBase accessionNone
Get sequence