MirGeneDB

MirGeneDB ID

Lgi-Mir-96-P3

Family name MIR-96 (all species)
Seed AUGGCAC
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-263b
Paralogues Lgi-Mir-96-P1a  Lgi-Mir-96-P1b  Lgi-Mir-96-P2 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_71: 756862-756922 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P3)
Mir-96-P3 LOTGIsca_71: 756862-756922 [+] Ensembl
Mir-96-P2 LOTGIsca_71: 757688-757745 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAAUGUCAUCGUAAACCGGUCCGACAGUGAAUGGCACUGGUAGAAUUCACGGUGUAAACCUUGUGUUCCGUGGUCUUCCGGUGUCAUACAUUGUUAGUCGGAAGUCAGCUUAUCAAGAAA
Get precursor sequence
Structure
        10        20            30        40        50        60 
AAAAUGUCAUCGUAAACCGG      ----|   A          U   AU      UGUAAAC 
                    UCCGAC    AGUG AUGGCACUGG AGA  UCACGG       \
                    AGGCUG    UUAC UACUGUGGCC UCU  GGUGCC       C
AAAGAACUAUUCGACUGA--      AUUG^   A          U   --      UUGUGUU 
 .       110         100        90        80          70
Deep sequencing
3' NTU Unknown
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Lgi-Mir-96-P3_5p (predicted)

MirBase accessionMIMAT0009584
Sequence
0- AAUGGCACUGGUAGAAUUCACGG -23
Get sequence
Star sequence

Lgi-Mir-96-P3_3p* (predicted)

MirBase accessionNone
Sequence
40- GUGGUCUUCCGGUGUCAUACA -61
Get sequence