
MirGeneDB ID


Family name MIR-96 (all species)
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-263a
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
scaffold_6500: 16780751-16780812 [+] Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30        40        50        60 
GUUUUCGUUGUUUCGCA---|    G   A  UA   G     GA   AU       GUUUUU 
                    UCUCG CAC GU  AUG CACUG  AGA  UCACGGG      C
                    AGGGC GUG UA  UAC GUGAU  UCU  AGUGCCC      U
AAGUCAACAACUUGCAUUAU^    -   G  UC   G     UC   --       GCACAA 
120       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
Tissue expression
Em Fe Ma Ma
Mature sequence


MirBase accessionMIMAT0008653
Get sequence
Star sequence


MirBase accessionNone
Get sequence