MirGeneDB

MirGeneDB ID

Bta-Mir-96-P1

Family name MIR-96 (all species)
Seed UUGGCAC
Species Cow (Bos taurus)
MiRBase ID bta-mir-96
Paralogues Bta-Mir-96-P2  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2 
Orthologues Ami-Mir-96-P1  Bfl-Mir-96-P1  Cfa-Mir-96-P1  Cgi-Mir-96-P1a  Cgi-Mir-96-P1b  Cin-Mir-96-P1  Cli-Mir-96-P1  Cpi-Mir-96-P1  Cpo-Mir-96-P1  Cte-Mir-96-P1  Dno-Mir-96-P1  Dre-Mir-96-P1  Efe-Mir-96-P1  Ete-Mir-96-P1  Gga-Mir-96-P1  Hsa-Mir-96-P1  Isc-Mir-96-P1  Lan-Mir-96-P1  Lgi-Mir-96-P1a  Lgi-Mir-96-P1b  Mdo-Mir-96-P1  Mml-Mir-96-P1  Mmu-Mir-96-P1  Oan-Mir-96-P1  Ocu-Mir-96-P1  Pfl-Mir-96-P1  Pmi-Mir-96-P1  Rno-Mir-96-P1  Sha-Mir-96-P1  Sko-Mir-96-P1  Spu-Mir-96-P1  Sto-Mir-96-P1  Tgu-Mir-96-P1  Xtr-Mir-96-P1 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr4: 94411209-94411272 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P1)
Mir-96-P2 chr4: 94406722-94406786 [-] UCSC Ensembl
Mir-96-P1 chr4: 94411209-94411272 [-] UCSC Ensembl
Mir-96-P3-v1 chr4: 94411434-94411495 [-] UCSC Ensembl
Mir-96-P3-v2 chr4: 94411435-94411494 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUCCGCACCACUACCGUCUGCUUGGCCGACUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCGCUCUGAGCAAUCAUGUGCAGUGCCAAUAUGGGAAAAGCAGGAUGCCACAGCCGUUCACC
Get precursor sequence
Structure
        10          20        30        40        50        60  
GUCCGCACCACUACCGU--|     GG  GACU        A      UU     UGUGUCUC 
                   CUGCUU  CC    UUGGCACU GCACAU  UUGCU        \
                   GACGAA  GG    AACCGUGA CGUGUA  AACGA        U
CCACUUGCCGACACCGUAG^     AA  GUAU        -      CU     GUCUCGCC 
  120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-96-P1_5p

MirBase accessionMIMAT0009388
Sequence
0- UUUGGCACUAGCACAUUUUUGCU -23
Get sequence
Validated targets TargetScanVert: bta-miR-96
Star sequence

Bta-Mir-96-P1_3p*

MirBase accessionNone
Sequence
42- CAAUCAUGUGCAGUGCCAAUAU -64
Get sequence