MirGeneDB

MirGeneDB ID

Isc-Mir-96-P1

Family name MIR-96 (all species)
Seed UUGGCAC
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-mir-96
Paralogues Isc-Mir-96-P2  Isc-Mir-96-P3 
Orthologues Ami-Mir-96-P1  Bfl-Mir-96-P1  Bta-Mir-96-P1  Cfa-Mir-96-P1  Cgi-Mir-96-P1a  Cgi-Mir-96-P1b  Cin-Mir-96-P1  Cli-Mir-96-P1  Cpi-Mir-96-P1  Cpo-Mir-96-P1  Cte-Mir-96-P1  Dno-Mir-96-P1  Dre-Mir-96-P1  Efe-Mir-96-P1  Ete-Mir-96-P1  Gga-Mir-96-P1  Hsa-Mir-96-P1  Lan-Mir-96-P1  Lgi-Mir-96-P1a  Lgi-Mir-96-P1b  Mdo-Mir-96-P1  Mml-Mir-96-P1  Mmu-Mir-96-P1  Oan-Mir-96-P1  Ocu-Mir-96-P1  Pfl-Mir-96-P1  Pmi-Mir-96-P1  Rno-Mir-96-P1  Sha-Mir-96-P1  Sko-Mir-96-P1  Spu-Mir-96-P1  Sto-Mir-96-P1  Tgu-Mir-96-P1  Xtr-Mir-96-P1 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
DS633978: 113225-113285 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CCCGCCGCCUGUCAAACUCGCCUUCCGUUUUUUGGCACUAGCACAUUUUUGUGUUUCGAUGCUACGACAAAAAUUGUGGUAGUGUCAAGCAAUAGGAAGAGUCUGCAAUGCGACCGAAAGA
Get precursor sequence
Structure
        10        20          30        40         50         
CCCGCCGCCUGUCAAACUC  -     -   U          G   -|       GUUUCG 
                   GC CUUCC GUU UUUGGCACUA CAC AUUUUUGU      A
                   UG GAAGG UAA GAACUGUGAU GUG UAAAAACA      U
AGAAAGCCAGCGUAACGUC  A     A   C          G   U^       GCAUCG 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Mir-96-P1_5p

MirBase accessionMIMAT0012708
Sequence
0- UUUGGCACUAGCACAUUUUUGU -22
Get sequence
Co-mature sequence

Isc-Mir-96-P1_3p

MirBase accessionNone
Sequence
39- AAAAUUGUGGUAGUGUCAAGCA -61
Get sequence