MirGeneDB

MirGeneDB ID

Pfl-Mir-96-P1

Family name MIR-96 (all species)
Seed UUGGCAC
Species Ptychodera (Ptychodera flava)
MiRBase ID
Paralogues Pfl-Mir-96-P2  Pfl-Mir-96-P3 
Orthologues Ami-Mir-96-P1  Bfl-Mir-96-P1  Bta-Mir-96-P1  Cfa-Mir-96-P1  Cgi-Mir-96-P1a  Cgi-Mir-96-P1b  Cin-Mir-96-P1  Cli-Mir-96-P1  Cpi-Mir-96-P1  Cpo-Mir-96-P1  Cte-Mir-96-P1  Dno-Mir-96-P1  Dre-Mir-96-P1  Efe-Mir-96-P1  Ete-Mir-96-P1  Gga-Mir-96-P1  Hsa-Mir-96-P1  Isc-Mir-96-P1  Lan-Mir-96-P1  Lgi-Mir-96-P1a  Lgi-Mir-96-P1b  Mdo-Mir-96-P1  Mml-Mir-96-P1  Mmu-Mir-96-P1  Oan-Mir-96-P1  Ocu-Mir-96-P1  Pmi-Mir-96-P1  Rno-Mir-96-P1  Sha-Mir-96-P1  Sko-Mir-96-P1  Spu-Mir-96-P1  Sto-Mir-96-P1  Tgu-Mir-96-P1  Xtr-Mir-96-P1 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Pfl)
LD345584.1: 198910-198968 [-]
Precursor
(pre-Mir +30nt flank)
AUGCACAAGGUAGUUCACGGUCACUUCCUCUUUGGCACUAGCACAUUUUGCUGUUAUUUCAGUCAGCGAAAGUAUGCUAGUGGCAAGGAGGGCGUGGUUAUCGUACAUCCGGGCAACUC
Get precursor sequence
Structure
        10          20        30        40         50        
AUGCACAAGGUAGUUCAC-- GU   U         G        CA-|      GUUAU 
                    G  CAC UCCUCUUUG CACUAGCA   UUUUGCU     U
                    U  GUG GGGAGGAAC GUGAUCGU   AAAGCGA     U
CUCAACGGGCCUACAUGCUA UG   C         G        AUG^      CUGAC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Pt
Mature sequence

Pfl-Mir-96-P1_5p

MirBase accessionNone
Sequence
0- UUUGGCACUAGCACAUUUUGCU -22
Get sequence
Star sequence

Pfl-Mir-96-P1_3p* (predicted)

MirBase accessionNone
Sequence
36- CGAAAGUAUGCUAGUGGCAAGGA -59
Get sequence