MirGeneDB

MirGeneDB ID

Rno-Mir-96-P2

Family name MIR-96 (all species)
Seed UUGGCAA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-182
Paralogues Rno-Mir-96-P1  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2 
Orthologues Aae-Mir-96-P2  Aca-Mir-96-P2  Ami-Mir-96-P2  Bfl-Mir-96-P2a  Bfl-Mir-96-P2b  Bfl-Mir-96-P2c  Bge-Mir-96-P2  Bta-Mir-96-P2  Cbr-Mir-96-P2f  Cbr-Mir-96-P2g  Cel-Mir-96-P2  Cfa-Mir-96-P2  Cgi-Mir-96-P2h  Cgi-Mir-96-P2i  Cin-Mir-96-P2  Cli-Mir-96-P2  Cpi-Mir-96-P2  Cpo-Mir-96-P2  Cte-Mir-96-P2  Dan-Mir-96-P2  Dme-Mir-96-P2  Dno-Mir-96-P2  Dpu-Mir-96-P2  Dre-Mir-96-P2  Efe-Mir-96-P2d  Efe-Mir-96-P2e  Ete-Mir-96-P2  Gga-Mir-96-P2  Hme-Mir-96-P2  Hsa-Mir-96-P2  Isc-Mir-96-P2  Lan-Mir-96-P2  Lgi-Mir-96-P2  Mdo-Mir-96-P2  Mml-Mir-96-P2  Mmu-Mir-96-P2  Oan-Mir-96-P2  Ocu-Mir-96-P2  Pfl-Mir-96-P2  Pmi-Mir-96-P2  Sha-Mir-96-P2  Sko-Mir-96-P2  Spu-Mir-96-P2  Sto-Mir-96-P2  Tca-Mir-96-P2  Xtr-Mir-96-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(rn6)
chr4: 57459736-57459800 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P2)
Mir-96-P2 chr4: 57459736-57459800 [-] UCSC Ensembl
Mir-96-P1 chr4: 57463385-57463448 [-] UCSC Ensembl
Mir-96-P3-v1 chr4: 57463591-57463652 [-] UCSC Ensembl
Mir-96-P3-v2 chr4: 57463592-57463651 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGUCUAGCUGCCGGAGGCCUCCCACCGUUUUUGGCAAUGGUAGAACUCACACCGGUAAGGUAACGGGACCCGGUGGUUCUAGACUUGCCAACUAUGGUGUAAGUGCCGAGCUGCCGAAAGAGGG
Get precursor sequence
Structure
        10          20        30        40        50        60   
GGGUCUAGCUGCCGGAG-  -| CC      UU       UGG      UCA    GGUAAGGU 
                  GC CU  CACCGU  UUGGCAA   UAGAAC   CACC        A
                  CG GA  GUGGUA  AACCGUU   AUCUUG   GUGG        A
GGGAGAAAGCCGUCGAGC  U^ AU      UC       CAG      ---    CCCAGGGC 
   120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-96-P2_5p

MirBase accessionNone
Sequence
0- UUUGGCAAUGGUAGAACUCACACC -24
Get sequence
Star sequence

Rno-Mir-96-P2_3p*

MirBase accessionMIMAT0005300
Sequence
44- UGGUUCUAGACUUGCCAACUA -65
Get sequence
Validated targets microrna.org: MIMAT0005300
TargetScanVert: rno-miR-182
miRDB: MIMAT0005300