MirGeneDB

MirGeneDB ID

Hsa-Mir-96-P2

Family name MIR-96 (all species)
Seed UUGGCAA
Species Human (Homo sapiens)
MiRBase ID hsa-mir-182
Paralogues Hsa-Mir-96-P1  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2 
Orthologues Aae-Mir-96-P2  Aca-Mir-96-P2  Ami-Mir-96-P2  Bfl-Mir-96-P2a  Bfl-Mir-96-P2b  Bfl-Mir-96-P2c  Bge-Mir-96-P2  Bta-Mir-96-P2  Cbr-Mir-96-P2f  Cbr-Mir-96-P2g  Cel-Mir-96-P2  Cfa-Mir-96-P2  Cgi-Mir-96-P2h  Cgi-Mir-96-P2i  Cin-Mir-96-P2  Cli-Mir-96-P2  Cpi-Mir-96-P2  Cpo-Mir-96-P2  Cte-Mir-96-P2  Dan-Mir-96-P2  Dme-Mir-96-P2  Dno-Mir-96-P2  Dpu-Mir-96-P2  Dre-Mir-96-P2  Efe-Mir-96-P2d  Efe-Mir-96-P2e  Ete-Mir-96-P2  Gga-Mir-96-P2  Hme-Mir-96-P2  Isc-Mir-96-P2  Lan-Mir-96-P2  Lgi-Mir-96-P2  Mdo-Mir-96-P2  Mml-Mir-96-P2  Mmu-Mir-96-P2  Oan-Mir-96-P2  Ocu-Mir-96-P2  Pfl-Mir-96-P2  Pmi-Mir-96-P2  Rno-Mir-96-P2  Sha-Mir-96-P2  Sko-Mir-96-P2  Spu-Mir-96-P2  Sto-Mir-96-P2  Tca-Mir-96-P2  Xtr-Mir-96-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(hg38)
chr7: 129770406-129770470 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P2)
Mir-96-P2 chr7: 129770406-129770470 [-] UCSC Ensembl
Mir-96-P1 chr7: 129774698-129774761 [-] UCSC Ensembl
Mir-96-P3-v1 chr7: 129774927-129774988 [-] UCSC Ensembl
Mir-96-P3-v2 chr7: 129774928-129774987 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUGGGGGGAGCUGCUUGCCUCCCCCCGUUUUUGGCAAUGGUAGAACUCACACUGGUGAGGUAACAGGAUCCGGUGGUUCUAGACUUGCCAACUAUGGGGCGAGGACUCAGCCGGCACCCUGUGC
Get precursor sequence
Structure
        10          20        30        40        50        60  
CCUGGGGGGAGCUGCUUG--|   C      UU       UGG      U   ACUGGUGAGG 
                    CCUC CCCCGU  UUGGCAA   UAGAAC CAC          U
                    GGAG GGGGUA  AACCGUU   AUCUUG GUG          A
CGUGUCCCACGGCCGACUCA^   C      UC       CAG      -   GCCUAGGACA 
   120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-96-P2_5p

MirBase accessionMIMAT0000259
Sequence
0- UUUGGCAAUGGUAGAACUCACACU -24
Get sequence
Validated targets microrna.org: MIMAT0000259
TargetScanVert: hsa-miR-182-5p
TargetMiner: hsa-miR-182-5p
miRDB: MIMAT0000259
Star sequence

Hsa-Mir-96-P2_3p*

MirBase accessionMIMAT0000260
Sequence
44- UGGUUCUAGACUUGCCAACUA -65
Get sequence
Validated targets microrna.org: MIMAT0000260
TargetScanVert: hsa-miR-182-3p
TargetMiner: hsa-miR-182-3p
miRDB: MIMAT0000260