MirGeneDB

MirGeneDB ID

Cel-Mir-96-P2

Family name MIR-96 (all species)
Seed UUGGCAC
Species Roundworm (Caenorhabditis elegans)
MiRBase ID cel-mir-790
Paralogues Cel-Mir-96-P3 
Orthologues Aae-Mir-96-P2  Aca-Mir-96-P2  Ami-Mir-96-P2  Bfl-Mir-96-P2a  Bfl-Mir-96-P2b  Bfl-Mir-96-P2c  Bge-Mir-96-P2  Bta-Mir-96-P2  Cbr-Mir-96-P2f  Cbr-Mir-96-P2g  Cfa-Mir-96-P2  Cgi-Mir-96-P2h  Cgi-Mir-96-P2i  Cin-Mir-96-P2  Cli-Mir-96-P2  Cpi-Mir-96-P2  Cpo-Mir-96-P2  Cte-Mir-96-P2  Dan-Mir-96-P2  Dme-Mir-96-P2  Dno-Mir-96-P2  Dpu-Mir-96-P2  Dre-Mir-96-P2  Efe-Mir-96-P2d  Efe-Mir-96-P2e  Ete-Mir-96-P2  Gga-Mir-96-P2  Hme-Mir-96-P2  Hsa-Mir-96-P2  Isc-Mir-96-P2  Lan-Mir-96-P2  Lgi-Mir-96-P2  Mdo-Mir-96-P2  Mml-Mir-96-P2  Mmu-Mir-96-P2  Oan-Mir-96-P2  Ocu-Mir-96-P2  Pfl-Mir-96-P2  Pmi-Mir-96-P2  Rno-Mir-96-P2  Sha-Mir-96-P2  Sko-Mir-96-P2  Spu-Mir-96-P2  Sto-Mir-96-P2  Tca-Mir-96-P2  Xtr-Mir-96-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ce11)
chrIV: 5566427-5566488 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P2)
Mir-96-P3 chrIV: 5562040-5562103 [+] UCSC Ensembl
Mir-96-P2 chrIV: 5566427-5566488 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCCCCUCAAAAAAAAAGUCCCUUCAGCCGGCUUGGCACUCGCGAACACCGCGAUUUCACUUAUAACUCGCGGCGUUAGCUCUGUGUCAAACCGGCGUAGCUGAUGACUCAGAUUUAAAAUGU
Get precursor sequence
Structure
        10        20          30        40         50          
UCCCCUCAAAAAAAAAGUCCCUUCA--     C       UC-| G   A     AUUUCAC 
                           GCCGG UUGGCAC   GC AAC CCGCG       \
                           CGGCC AACUGUG   CG UUG GGCGC       U
UGUAAAAUUUAGACUCAGUAGUCGAUG     A       UCU^ A   C     UCAAUAU 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Wt Da Ea Mi Yo Yo
Mature sequence

Cel-Mir-96-P2_5p

MirBase accessionMIMAT0004225
Sequence
0- CUUGGCACUCGCGAACACCGCG -22
Get sequence
Validated targets microrna.org: MIMAT0004225
TargetScanWorm: cel-miR-790
Star sequence

Cel-Mir-96-P2_3p*

MirBase accessionMIMAT0020349
Sequence
39- CGGCGUUAGCUCUGUGUCAAACC -62
Get sequence