MirGeneDB

MirGeneDB ID

Ocu-Mir-96-P3-v2

Family name MIR-96 (all species)
Seed UGGCACU
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID ocu-mir-183
Paralogues Ocu-Mir-96-P1  Ocu-Mir-96-P2  Ocu-Mir-96-P3-v1 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Isc-Mir-96-P3  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(oryCun2)
chr7: 14826895-14826954 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-96-P3-v2)
Mir-96-P3-v1 chr7: 14826894-14826955 [+] UCSC Ensembl
Mir-96-P3-v2 chr7: 14826895-14826954 [+] UCSC Ensembl
Mir-96-P1 chr7: 14827059-14827122 [+] UCSC Ensembl
Mir-96-P2 chr7: 14830047-14830110 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGGCCGGAGAGUGUGACUCCUGUUCUGUGUAUGGCACUGGUAGAAUUCACUGUGAACAGUCUCGGUCAGUGAAUUACCGAAGGGCCAUAAACAGAGCAGAGACAGAUCCGCGAGGGCCUC
Get precursor sequence
Structure
        10          20        30          40        50         
CGGCCGGAGAGUGUGAC-  -         G      AC--|    GA        UGAACA 
                  UC CUGUUCUGU UAUGGC    UGGUA  AUUCACUG      G
                  AG GACGAGACA AUACCG    GCCAU  UAAGUGAC      U
CUCCGGGAGCGCCUAGAC  A         A      GGAA^    --        UGGCUC 
.       110       100        90        80          70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
He Ki Te To Wh
Mature sequence

Ocu-Mir-96-P3-v2_5p

MirBase accessionMIMAT0048287
Sequence
0- AUGGCACUGGUAGAAUUCACUG -22
Get sequence
Star sequence

Ocu-Mir-96-P3-v2_3p* (predicted)

MirBase accessionMIMAT0048288
Sequence
38- GUGAAUUACCGAAGGGCCAUAA -60
Get sequence