MirGeneDB

MirGeneDB ID

Sto-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-23-o1  Sto-Mir-23-o2  Sto-Mir-23-P1 
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01002700.1: 246394-246453 [-]
Precursor
(pre-Mir +30nt flank)
UGCAAAUUUCCUUUCAUGUUGUGGCCGAGUGGGUUCCUGGCAUACUGAUUUGUGACAUGAGAUAAAAAUCACAUUGCCAGGGAUUACCACAUAGUCACUGCCUUGACUGCUGUUCUGGAA
Get precursor sequence
Structure
        10          20        30          40        50        
UGCAAAUUUCCUUUCAU--  U     CGA    --|         UAC      GUGACA 
                   GU GUGGC   GUGG  GUUCCUGGCA   UGAUUU      U
                   CG CACUG   CACC  UAGGGACCGU   ACUAAA      G
AAGGUCUUGUCGUCAGUUC  U     AUA    AU^         UAC      AAUAGA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Sto-Mir-23-P2_5p*

MirBase accessionNone
Sequence
0- GGGUUCCUGGCAUACUGAUUU -21
Get sequence
Mature sequence

Sto-Mir-23-P2_3p

MirBase accessionNone
Sequence
37- AUCACAUUGCCAGGGAUUACCAC -60
Get sequence