MirGeneDB

MirGeneDB ID

Tgu-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-23
Paralogues
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(taeGut3.2.4)
Z: 9900653-9900712 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-24-P2 Z: 9899811-9899870 [-] UCSC Ensembl
Mir-27-P2 Z: 9900334-9900396 [-] UCSC Ensembl
Mir-23-P2 Z: 9900653-9900712 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACAGGUUUCUUUUAAUGUUAUGGCUGUUUGGGUUCCUGGCAUGAUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAGCCAUGACCACAGCUGCUAGCAUGAAA
Get precursor sequence
Structure
        10          20        30          40         50        
CACAGGUUUCUUUUAAU--           U   --         -|  A      GUGACU 
                   GUUAUGGCUGU UGG  GUUCCUGGC AUG UGAUUU      U
                   CAGUACCGACG ACC  UAGGGACCG UAC ACUAAA      A
AAAGUACGAUCGUCGACAC           C   AU         U^  -      AUUAGA 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site -1 on the 5p arm relative to what is annotated here.
3' NTU Yes
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Star sequence

Tgu-Mir-23-P2_5p*

MirBase accessionMIMAT0014644
Sequence
0- GGGUUCCUGGCAUGAUGAUUU -21
Get sequence
Mature sequence

Tgu-Mir-23-P2_3p

MirBase accessionMIMAT0014566
Sequence
37- AUCACAUUGCCAGGGAUUACCAC -60
Get sequence