MirGeneDB

MirGeneDB ID

Ocu-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID ocu-mir-23b
Paralogues
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(oryCun2)
chr1: 74102158-74102217 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-23-P2 chr1: 74102158-74102217 [+] UCSC Ensembl
Mir-27-P2 chr1: 74102379-74102441 [+] UCSC Ensembl
Mir-24-P2 chr1: 74102787-74102846 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGCGCUGCCCUCUGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGCUGCUCCUCCAGAG
Get precursor sequence
Structure
        10         20         30          40         50        
AGGCGCUGCCCUCUGGUGC-  -   C   U   --         -|  C      GUGACU 
                    UC UGG UGC UGG  GUUCCUGGC AUG UGAUUU      U
                    AG ACC ACG ACC  UAGGGACCG UAC ACUAAA      A
GAGACCUCCUCGUCGGUUCC  C   A   C   AU         U^  -      AUUAGA 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
He Ki Te To Wh
Star sequence

Ocu-Mir-23-P2_5p*

MirBase accessionMIMAT0048128
Sequence
0- GGGUUCCUGGCAUGCUGAUUU -21
Get sequence
Mature sequence

Ocu-Mir-23-P2_3p

MirBase accessionMIMAT0048129
Sequence
37- AUCACAUUGCCAGGGAUUACCAC -60
Get sequence