MirGeneDB

MirGeneDB ID

Mml-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Rhesus monkey (Macaca mulatta)
MiRBase ID mml-mir-23b
Paralogues Mml-Mir-23-P1 
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rheMac8)
chr15: 108904086-108904146 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-23-P2 chr15: 108904086-108904146 [+] UCSC Ensembl
Mir-27-P2 chr15: 108904322-108904384 [+] UCSC Ensembl
Mir-24-P2 chr15: 108904881-108904940 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCGGCGCUGCUCUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGCUGCUGCUCCAGAA
Get precursor sequence
Structure
        10        20         30          40         50         
GCGGCGCUGCUCUCAGGUGC  -   C   U   --         -|  C      GUGACU 
                    UC UGG UGC UGG  GUUCCUGGC AUG UGAUUU      U
                    AG ACC ACG ACC  UAGGGACCG UAC ACUAAA      A
AAGACCUCGUCGUCGGUUCC  C   A   C   AU         U^  -      AUUAGA 
 .       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
CommentThe Drosha cut on the 5p arm is -1 relative to the other vertebrates.
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Bo Br Br Br He Ki Li Lu Ly Sk Sp Te Th
Star sequence

Mml-Mir-23-P2_5p*

MirBase accessionMIMAT0026800
Sequence
0- UGGGUUCCUGGCAUGCUGAUUU -22
Get sequence
Validated targets TargetScanVert: mml-miR-23b-5p
Mature sequence

Mml-Mir-23-P2_3p

MirBase accessionMIMAT0006165
Sequence
38- AUCACAUUGCCAGGGAUUACCAC -61
Get sequence
Validated targets TargetScanVert: mml-miR-23b-3p