MirGeneDB

MirGeneDB ID

Dre-Mir-23-P2a

Family name MIR-23 (all species)
Seed UCACAUU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-23b
Paralogues Dre-Mir-23-P1  Dre-Mir-23-P2b  Dre-Mir-23-P3  Dre-Mir-23-P4 
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) D. rerio
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr10: 15954588-15954651 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P2a)
Mir-23-P2a chr10: 15954588-15954651 [+] UCSC Ensembl
Mir-27-P2a chr10: 15954740-15954804 [+] UCSC Ensembl
Mir-24-P2a chr10: 15960848-15960904 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GACGGGGGUCUCCAGCUUGUUGUGGCUGUGUGGGUUCUUGGCAUGCUGAUUUGUGACUGUAGUAAAAAAAAAUCACAUUGCCAGGGAUUACCACACUACCACGGCAUUACCAGCAGUUCAUGAG
Get precursor sequence
Structure
        10         20        30          40         50        60 
GACGGGGGUCUCCAGCU-        CU      --         -|  C      GUGACUGU 
                  UGUUGUGG  GUGUGG  GUUCUUGGC AUG UGAUUU        \
                  ACGGCACC  CACACC  UAGGGACCG UAC ACUAAA        A
GAGUACUUGACGACCAUU        AU      AU         U^  -      AAAAAAUG 
  120       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentFor many taxa there is often a higher set of 5p reads shifted -1 relative to what is annotated here. However the 5'moR reads support what is annotated here as the actual Drosha cut in relation to the phylogenetically conserved Group 2 3' arm.
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-23-P2a_5p*

MirBase accessionNone
Sequence
0- UGGGUUCUUGGCAUGCUGAUUU -22
Get sequence
Mature sequence

Dre-Mir-23-P2a_3p

MirBase accessionMIMAT0001791
Sequence
41- AUCACAUUGCCAGGGAUUACCAC -64
Get sequence
Validated targets TargetScanFish: dre-miR-23b