MirGeneDB

MirGeneDB ID

Cli-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-23b
Paralogues
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold226: 156772-156831 [+]
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-23-P2 scaffold226: 156772-156831 [+]
Mir-27-P2 scaffold226: 157004-157066 [+]
Precursor
(pre-Mir +30nt flank)
CACAGCUUUCUUCUCAUGUUGUGGCUGUUUGGGUUCCUGGCAUGAUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACACAGCCAUUACUGCAGCUGCUAGUAUGAAA
Get precursor sequence
Structure
        10          20        30          40         50        
CACAGCUUUCUUCUCAU--  U        U   --         -|  A      GUGACU 
                   GU GUGGCUGU UGG  GUUCCUGGC AUG UGAUUU      U
                   CA UACCGACA ACC  UAGGGACCG UAC ACUAAA      A
AAAGUAUGAUCGUCGACGU  U        C   AU         U^  -      AUUAGA 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Cli-Mir-23-P2_5p*

MirBase accessionMIMAT0038440
Sequence
0- GGGUUCCUGGCAUGAUGAUUU -21
Get sequence
Mature sequence

Cli-Mir-23-P2_3p

MirBase accessionMIMAT0038441
Sequence
37- AUCACAUUGCCAGGGAUUACCAC -60
Get sequence