MirGeneDB

MirGeneDB ID

Sha-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Tasmanian devil (Sarcophilus harrisii)
MiRBase ID sha-mir-23b
Paralogues Sha-Mir-23-P1 
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(DEVIL7_traces)
GL841474.1: 1159875-1159934 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-23-P2 GL841474.1: 1159875-1159934 [+] UCSC Ensembl
Mir-27-P2 GL841474.1: 1160088-1160150 [+] UCSC Ensembl
Mir-24-P2 GL841474.1: 1160665-1160724 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCAUGAUUUUCUUGAGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAGCCAUGACGUUGGCUGCUCUUCCAGA
Get precursor sequence
Structure
        10        20         30          40         50         
ACCAUGAUUUUCUUGAGUGC  -       U   --         -|  C      GUGACU 
                    UC UGGCUGC UGG  GUUCCUGGC AUG UGAUUU      U
                    AG ACCGACG ACC  UAGGGACCG UAC ACUAAA      A
AGACCUUCUCGUCGGUUGC-  U       C   AU         U^  -      AUUAGA 
.       110        100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Bo Br He Ki Li Ly Pa Sk Sp Te
Star sequence

Sha-Mir-23-P2_5p*

MirBase accessionNone
Sequence
0- UGGGUUCCUGGCAUGCUGAUUU -22
Get sequence
Mature sequence

Sha-Mir-23-P2_3p

MirBase accessionMIMAT0022788
Sequence
38- AUCACAUUGCCAGGGAUUACCA -60
Get sequence