MirGeneDB

MirGeneDB ID

Sha-Mir-27-P2

Family name MIR-27 (all species)
Seed UCACAGU
Species Tasmanian devil (Sarcophilus harrisii)
MiRBase ID sha-mir-27b
Paralogues Sha-Mir-27-P1 
Orthologues Aca-Mir-27-P2  Ami-Mir-27-P2  Bta-Mir-27-P2  Cfa-Mir-27-P2  Cli-Mir-27-P2  Cpi-Mir-27-P2  Cpo-Mir-27-P2  Dno-Mir-27-P2  Dre-Mir-27-P2a  Dre-Mir-27-P2b  Ete-Mir-27-P2  Gga-Mir-27-P2  Hsa-Mir-27-P2  Mdo-Mir-27-P2  Mml-Mir-27-P2  Mmu-Mir-27-P2  Oan-Mir-27-P2  Ocu-Mir-27-P2  Rno-Mir-27-P2  Sto-Mir-27-P2  Tgu-Mir-27-P2  Xtr-Mir-27-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(DEVIL7_traces)
GL841474.1: 1160088-1160150 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-27-P2)
Mir-23-P2 GL841474.1: 1159875-1159934 [+] UCSC Ensembl
Mir-27-P2 GL841474.1: 1160088-1160150 [+] UCSC Ensembl
Mir-24-P2 GL841474.1: 1160665-1160724 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUCAGAGGACGACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUAAUUGAUUUCCUCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUGAGAUGGGAACCUUA
Get precursor sequence
Structure
        10          20        30        40        50        60  
GCUCAGAGGACGACCUC--|  AACA                  AUUG       GUAAUUGA 
                   UCU    AGGUGCAGAGCUUAGCUG    GUGAACA        \
                   AGA    UCCACGUCUUGAAUCGGU    CACUUGU        U
AUUCCAAGGGUAGAGUGGA^  GAAG                  GA--       UUCUCCUU 
 120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Br He Ki Li Ly Pa Sk Sp Te
Star sequence

Sha-Mir-27-P2_5p*

MirBase accessionNone
Sequence
0- AGAGCUUAGCUGAUUGGUGAACA -23
Get sequence
Mature sequence

Sha-Mir-27-P2_3p

MirBase accessionMIMAT0022789
Sequence
42- UUCACAGUGGCUAAGUUCUGC -63
Get sequence