MirGeneDB

MirGeneDB ID

Aca-Mir-27-P2

Family name MIR-27 (all species)
Seed UCACAGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-27b
Paralogues Aca-Mir-27-P1 
Orthologues Ami-Mir-27-P2  Bta-Mir-27-P2  Cfa-Mir-27-P2  Cli-Mir-27-P2  Cpi-Mir-27-P2  Cpo-Mir-27-P2  Dno-Mir-27-P2  Dre-Mir-27-P2a  Dre-Mir-27-P2b  Ete-Mir-27-P2  Gga-Mir-27-P2  Hsa-Mir-27-P2  Mdo-Mir-27-P2  Mml-Mir-27-P2  Mmu-Mir-27-P2  Oan-Mir-27-P2  Ocu-Mir-27-P2  Rno-Mir-27-P2  Sha-Mir-27-P2  Sto-Mir-27-P2  Tgu-Mir-27-P2  Xtr-Mir-27-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
2: 40591779-40591841 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-27-P2)
Mir-24-P2 2: 40591325-40591384 [-] UCSC Ensembl
Mir-27-P2 2: 40591779-40591841 [-] UCSC Ensembl
Mir-23-P2 2: 40592005-40592064 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUUCGGAGGAAGACCUCUCUGGUGAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGAUUUCCUCUUUGUUCACAGUGGCUAAGUUCUGCACCUAAAGAGAAGUUGAGAUGGAAACUUGA
Get precursor sequence
Structure
        10            20        30        40        50        60  
GUUCGGAGGAAGACCUC----|  GGUG                  AUUG       GUGAUUGA 
                     UCU    AGGUGCAGAGCUUAGCUG    GUGAACA        \
                     AGA    UCCACGUCUUGAAUCGGU    CACUUGU        U
AGUUCAAAGGUAGAGUUGAAG^  AA--                  GA--       UUCUCCUU 
 120       110       100          90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-27-P2_5p*

MirBase accessionMIMAT0021907
Sequence
0- AGAGCUUAGCUGAUUGGUGAACA -23
Get sequence
Mature sequence

Aca-Mir-27-P2_3p

MirBase accessionMIMAT0021908
Sequence
42- UUCACAGUGGCUAAGUUCUGC -63
Get sequence