MirGeneDB

MirGeneDB ID

Dre-Mir-27-P2b

Family name MIR-27 (all species)
Seed UCACAGU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-27b
Paralogues Dre-Mir-27-P1  Dre-Mir-27-P2a  Dre-Mir-27-P3  Dre-Mir-27-P4 
Orthologues Aca-Mir-27-P2  Ami-Mir-27-P2  Bta-Mir-27-P2  Cfa-Mir-27-P2  Cli-Mir-27-P2  Cpi-Mir-27-P2  Cpo-Mir-27-P2  Dno-Mir-27-P2  Ete-Mir-27-P2  Gga-Mir-27-P2  Hsa-Mir-27-P2  Mdo-Mir-27-P2  Mml-Mir-27-P2  Mmu-Mir-27-P2  Oan-Mir-27-P2  Ocu-Mir-27-P2  Rno-Mir-27-P2  Sha-Mir-27-P2  Sto-Mir-27-P2  Tgu-Mir-27-P2  Xtr-Mir-27-P2 
Node of Origin (locus) D. rerio
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr8: 30167449-30167508 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-27-P2b)
Mir-24-P2b chr8: 30162533-30162589 [-] UCSC Ensembl
Mir-27-P2b chr8: 30167449-30167508 [-] UCSC Ensembl
Mir-23-P2b chr8: 30167636-30167695 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAGGCCGAGAACUCUUUUCUAGCAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGAACUCUUUGUUCACAGUGGCUAAGUUCUGCAUCUGAGGAGAGGAUGACAGACUGAGGAAG
Get precursor sequence
Structure
        10         20         30        40        50        60
GCAGGCCGAGAACUCUU-    AG-|                  AUUG       GUGAUU 
                  UUCU   CAGGUGCAGAGCUUAGCUG    GUGAACA      G
                  GAGA   GUCUACGUCUUGAAUCGGU    CACUUGU      A
GAAGGAGUCAGACAGUAG    GGA^                  GA--       UUCUCA 
.       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-27-P2b_5p*

MirBase accessionMIMAT0031950
Sequence
0- AGAGCUUAGCUGAUUGGUGAACA -23
Get sequence
Mature sequence

Dre-Mir-27-P2b_3p

MirBase accessionMIMAT0001797
Sequence
39- UUCACAGUGGCUAAGUUCUGC -60
Get sequence
Validated targets TargetScanFish: dre-miR-27b