MirGeneDB

MirGeneDB ID

Dre-Mir-24-P2b

Family name MIR-24 (all species)
Seed GCCUACU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-24-3
Paralogues Dre-Mir-24-P1  Dre-Mir-24-P2a  Dre-Mir-24-P3  Dre-Mir-24-P4 
Orthologues Aca-Mir-24-P2  Ami-Mir-24-P2  Bta-Mir-24-P2  Cfa-Mir-24-P2  Cpi-Mir-24-P2  Cpo-Mir-24-P2  Dno-Mir-24-P2  Ete-Mir-24-P2  Gga-Mir-24-P2  Hsa-Mir-24-P2  Mdo-Mir-24-P2  Mml-Mir-24-P2  Mmu-Mir-24-P2  Oan-Mir-24-P2  Ocu-Mir-24-P2  Rno-Mir-24-P2  Sha-Mir-24-P2  Sto-Mir-24-o2  Sto-Mir-24-P2  Tgu-Mir-24-P2  Xtr-Mir-24-P2 
Node of Origin (locus) D. rerio
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr8: 30162533-30162589 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P2b)
Mir-24-P2b chr8: 30162533-30162589 [-] UCSC Ensembl
Mir-27-P2b chr8: 30167449-30167508 [-] UCSC Ensembl
Mir-23-P2b chr8: 30167636-30167695 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUAUGAGAGAUAGAUGGAGCUGGCCUCCCGUGCCUACUGAGCUGAUUACAGUACUGUGCAAACACUGGCUCAGUUCAGCAGGAACAGGAGUCUGGUCCACAAACUCCACCAAACACU
Get precursor sequence
Structure
        10           20        30        40        50        
AUAUGAGAGAUAGAUGGA---| UG C    C  G   A         UUA    ACUGU 
                     GC  G CUCC GU CCU CUGAGCUGA   CAGU     \
                     UG  C GAGG CA GGA GACUUGACU   GUCA     G
UCACAAACCACCUCAAACACC^ GU U    A  A   C         CG-    CAAAC 
     110       100        90        80        70         60
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site -1 on the 5p arm relative to what is annotated here.
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-24-P2b_5p

MirBase accessionNone
Sequence
0- UGCCUACUGAGCUGAUUACAGU -22
Get sequence
Co-mature sequence

Dre-Mir-24-P2b_3p

MirBase accessionMIMAT0001792
Sequence
35- UGGCUCAGUUCAGCAGGAACAG -57
Get sequence
Validated targets TargetScanFish: dre-miR-24