MirGeneDB

MirGeneDB ID

Rno-Mir-24-P2

Family name MIR-24 (all species)
Seed GGCUCAG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-24-1
Paralogues Rno-Mir-24-P1 
Orthologues Aca-Mir-24-P2  Ami-Mir-24-P2  Bta-Mir-24-P2  Cfa-Mir-24-P2  Cpi-Mir-24-P2  Cpo-Mir-24-P2  Dno-Mir-24-P2  Dre-Mir-24-P2a  Dre-Mir-24-P2b  Ete-Mir-24-P2  Gga-Mir-24-P2  Hsa-Mir-24-P2  Mdo-Mir-24-P2  Mml-Mir-24-P2  Mmu-Mir-24-P2  Oan-Mir-24-P2  Ocu-Mir-24-P2  Sha-Mir-24-P2  Sto-Mir-24-o2  Sto-Mir-24-P2  Tgu-Mir-24-P2  Xtr-Mir-24-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr17: 823973-824032 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P2)
Mir-23-P2 chr17: 823242-823301 [+] UCSC Ensembl
Mir-27-P2 chr17: 823479-823541 [+] UCSC Ensembl
Mir-24-P2 chr17: 823973-824032 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGCCCAGCUGUGAUUGGACCCGCCCUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUCACACACUGGCUCAGUUCAGCAGGAACAGGAGUCGAGCCCUUGAGCAAAAAGCCUACCC
Get precursor sequence
Structure
        10        20           30        40        50          
CUGCCCAGCUGUGAUUGGACC---| CC    G  G   A         UA     UCUCAU 
                        CG  CUCC GU CCU CUGAGCUGA  UCAGU      \
                        GC  GAGG CA GGA GACUUGACU  GGUCA      U
CCCAUCCGAAAAACGAGUUCCCGA^ U-    A  A   C         C-     CACACU 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-24-P2_5p*

MirBase accessionMIMAT0003153
Sequence
0- GUGCCUACUGAGCUGAUAUCAGU -23
Get sequence
Validated targets microrna.org: MIMAT0003153
TargetScanVert: rno-miR-24-1-5p
miRDB: MIMAT0003153
Mature sequence

Rno-Mir-24-P2_3p

MirBase accessionMIMAT0000794
Sequence
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence
Validated targets microrna.org: MIMAT0000794
TargetScanVert: rno-miR-24-3p
miRDB: MIMAT0000794