MirGeneDB

MirGeneDB ID

Mdo-Mir-24-P2

Family name MIR-24 (all species)
Seed GGCUCAG
Species Gray short-tailed opossum (Monodelphis domestica)
MiRBase ID mdo-mir-24-1
Paralogues Mdo-Mir-24-P1 
Orthologues Aca-Mir-24-P2  Ami-Mir-24-P2  Bta-Mir-24-P2  Cfa-Mir-24-P2  Cpi-Mir-24-P2  Cpo-Mir-24-P2  Dno-Mir-24-P2  Dre-Mir-24-P2a  Dre-Mir-24-P2b  Ete-Mir-24-P2  Gga-Mir-24-P2  Hsa-Mir-24-P2  Mml-Mir-24-P2  Mmu-Mir-24-P2  Oan-Mir-24-P2  Ocu-Mir-24-P2  Rno-Mir-24-P2  Sha-Mir-24-P2  Sto-Mir-24-o2  Sto-Mir-24-P2  Tgu-Mir-24-P2  Xtr-Mir-24-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(monDom5)
6: 17696509-17696568 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P2)
Mir-23-P2 6: 17695908-17695968 [+] UCSC Ensembl
Mir-27-P2 6: 17696108-17696170 [+] UCSC Ensembl
Mir-24-P2 6: 17696509-17696568 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUCUGAGCUGUCCGUUGGACCCGCCCUCCGGUGCCUACUGAGCUGAUAACAGUUCUGAUUUUACACACUGGCUCAGUUCAGCAGGAACAGGAGUCGAGCCCGAGAGCGAGAAGGACAAGC
Get precursor sequence
Structure
        10        20           30        40        50          
GUCUGAGCUGUCCGUUGGACC---| CC    G  G   A         UAA    UCUGAU 
                        CG  CUCC GU CCU CUGAGCUGA   CAGU      \
                        GC  GAGG CA GGA GACUUGACU   GUCA      U
CGAACAGGAAGAGCGAGAGCCCGA^ U-    A  A   C         CG-    CACAUU 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Mdo-Mir-24-P2_5p*

MirBase accessionNone
Sequence
0- GUGCCUACUGAGCUGAUAACAGU -23
Get sequence
Mature sequence

Mdo-Mir-24-P2_3p

MirBase accessionMIMAT0004175
Sequence
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence
Validated targets TargetScanVert: mdo-miR-24-3p