MirGeneDB

MirGeneDB ID

Sto-Mir-24-P2

Family name MIR-24 (all species)
Seed GGCUCAG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-24-o1  Sto-Mir-24-o2  Sto-Mir-24-P1 
Orthologues Aca-Mir-24-P2  Ami-Mir-24-P2  Bta-Mir-24-P2  Cfa-Mir-24-P2  Cpi-Mir-24-P2  Cpo-Mir-24-P2  Dno-Mir-24-P2  Dre-Mir-24-P2a  Dre-Mir-24-P2b  Ete-Mir-24-P2  Gga-Mir-24-P2  Hsa-Mir-24-P2  Mdo-Mir-24-P2  Mml-Mir-24-P2  Mmu-Mir-24-P2  Oan-Mir-24-P2  Ocu-Mir-24-P2  Rno-Mir-24-P2  Sha-Mir-24-P2  Tgu-Mir-24-P2  Xtr-Mir-24-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01002700.1: 238946-239005 [-]
Precursor
(pre-Mir +30nt flank)
AACCCAGCCAGGAUGUGGACCUGAUCUCUCGUGCCUACUGAACUGAUAACAGUUACUAUAUUACAUACUGGCUCAGUUCAGCAGGAACAGGAGUUGGGCCCUUAAGCUACGCCGUUCCGA
Get precursor sequence
Structure
        10           20        30        40        50          
AACCCAGCCAGGAUGUGGA---| UG U   UC  G   A         UAA    UACUAU 
                      CC  A CUC  GU CCU CUGAACUGA   CAGU      \
                      GG  U GAG  CA GGA GACUUGACU   GUCA      A
AGCCUUGCCGCAUCGAAUUCCC^ GU -   GA  A   C         CG-    UACAUU 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-24-P2_5p*

MirBase accessionNone
Sequence
0- GUGCCUACUGAACUGAUAACAGU -23
Get sequence
Mature sequence

Sto-Mir-24-P2_3p

MirBase accessionNone
Sequence
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence