MirGeneDB

MirGeneDB ID

Dre-Mir-24-P2a

Family name MIR-24 (all species)
Seed GGCUCAG
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-24-1
Paralogues Dre-Mir-24-P1  Dre-Mir-24-P2b  Dre-Mir-24-P3  Dre-Mir-24-P4 
Orthologues Aca-Mir-24-P2  Ami-Mir-24-P2  Bta-Mir-24-P2  Cfa-Mir-24-P2  Cpi-Mir-24-P2  Cpo-Mir-24-P2  Dno-Mir-24-P2  Ete-Mir-24-P2  Gga-Mir-24-P2  Hsa-Mir-24-P2  Mdo-Mir-24-P2  Mml-Mir-24-P2  Mmu-Mir-24-P2  Oan-Mir-24-P2  Ocu-Mir-24-P2  Rno-Mir-24-P2  Sha-Mir-24-P2  Sto-Mir-24-o2  Sto-Mir-24-P2  Tgu-Mir-24-P2  Xtr-Mir-24-P2 
Node of Origin (locus) D. rerio
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr10: 15960848-15960904 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P2a)
Mir-23-P2a chr10: 15954588-15954651 [+] UCSC Ensembl
Mir-27-P2a chr10: 15954740-15954804 [+] UCSC Ensembl
Mir-24-P2a chr10: 15960848-15960904 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGUGUGUCUCAUCAGGACCUGAGCUCCGGUGCCUUCUGAGCUGAUAUCAGUUGUAGUAAAUCACUGGCUCAGUUCAGCAGGAACAGGAGUGUGGCCCCUCCACAAAGAAGCACACA
Get precursor sequence
Structure
        10            20        30        40        50        
UUGUGUGUCUCAUCAGGA----| UGA     G  G   U         UA     UGUAG 
                      CC   GCUCC GU CCU CUGAGCUGA  UCAGU     \
                      GG   UGAGG CA GGA GACUUGACU  GGUCA     U
ACACACGAAGAAACACCUCCCC^ UG-     A  A   C         C-     CUAAA 
     110       100         90        80        70         60
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site -1 on the 5p arm relative to what is annotated here.
3' NTU Yes
MotifsUGUG in loop
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-24-P2a_5p*

MirBase accessionNone
Sequence
0- UGCCUUCUGAGCUGAUAUCAGU -22
Get sequence
Mature sequence

Dre-Mir-24-P2a_3p

MirBase accessionMIMAT0001792
Sequence
35- UGGCUCAGUUCAGCAGGAACAG -57
Get sequence
Validated targets TargetScanFish: dre-miR-24