MirGeneDB

MirGeneDB ID

Bta-Mir-24-P2

Family name MIR-24 (all species)
Seed GGCUCAG
Species Cow (Bos taurus)
MiRBase ID bta-mir-24-1
Paralogues Bta-Mir-24-P1 
Orthologues Aca-Mir-24-P2  Ami-Mir-24-P2  Cfa-Mir-24-P2  Cpi-Mir-24-P2  Cpo-Mir-24-P2  Dno-Mir-24-P2  Dre-Mir-24-P2a  Dre-Mir-24-P2b  Ete-Mir-24-P2  Gga-Mir-24-P2  Hsa-Mir-24-P2  Mdo-Mir-24-P2  Mml-Mir-24-P2  Mmu-Mir-24-P2  Oan-Mir-24-P2  Ocu-Mir-24-P2  Rno-Mir-24-P2  Sha-Mir-24-P2  Sto-Mir-24-o2  Sto-Mir-24-P2  Tgu-Mir-24-P2  Xtr-Mir-24-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr8: 83010382-83010441 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P2)
Mir-2475 chr8: 83008960-83009020 [+] UCSC Ensembl
Mir-23-P2 chr8: 83009615-83009674 [+] UCSC Ensembl
Mir-27-P2 chr8: 83009841-83009903 [+] UCSC Ensembl
Mir-24-P2 chr8: 83010382-83010441 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUCCGGGCUGUCAGUUGGACCCGCCCUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUUACACACUGGCUCAGUUCAGCAGGAACAGGAGUCGAGCCCUAGAGCAAAGCCUUCCUGU
Get precursor sequence
Structure
        10        20           30        40        50          
CUCCGGGCUGUCAGUUGGACC---| CC    G  G   A         UA     UCUCAU 
                        CG  CUCC GU CCU CUGAGCUGA  UCAGU      \
                        GC  GAGG CA GGA GACUUGACU  GGUCA      U
UGUCCUUCCGAAACGAGAUCCCGA^ U-    A  A   C         C-     CACAUU 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-24-P2_5p*

MirBase accessionMIMAT0009250
Sequence
0- GUGCCUACUGAGCUGAUAUCAGU -23
Get sequence
Validated targets TargetScanVert: bta-miR-24
Mature sequence

Bta-Mir-24-P2_3p

MirBase accessionNone
Sequence
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence