MirGeneDB

MirGeneDB ID

Ami-Mir-24-P2

Family name MIR-24 (all species)
Seed GGCUCAG
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-24-1
Paralogues Ami-Mir-24-P1 
Orthologues Aca-Mir-24-P2  Bta-Mir-24-P2  Cfa-Mir-24-P2  Cpi-Mir-24-P2  Cpo-Mir-24-P2  Dno-Mir-24-P2  Dre-Mir-24-P2a  Dre-Mir-24-P2b  Ete-Mir-24-P2  Gga-Mir-24-P2  Hsa-Mir-24-P2  Mdo-Mir-24-P2  Mml-Mir-24-P2  Mmu-Mir-24-P2  Oan-Mir-24-P2  Ocu-Mir-24-P2  Rno-Mir-24-P2  Sha-Mir-24-P2  Sto-Mir-24-o2  Sto-Mir-24-P2  Tgu-Mir-24-P2  Xtr-Mir-24-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(allMis1)
JH734258: 395350-395409 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-24-P2)
Mir-23-P2 JH734258: 394547-394606 [+] UCSC
Mir-27-P2 JH734258: 394776-394838 [+] UCSC
Mir-24-P2 JH734258: 395350-395409 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GUUCCAGGCUGUGGAUGGACCCGUCCUCCAGUGCCUACUGAGCUGAUAUCAGUUCUGAUUUUACAUACUGGCUCAGUUCAGCAGGAACAGGAGUCGAGCCCCAAAGCAAAAAGAUGUACC
Get precursor sequence
Structure
        10        20           30        40        50          
GUUCCAGGCUGUGGAUGGACC---| UC    A  G   A         UA     UCUGAU 
                        CG  CUCC GU CCU CUGAGCUGA  UCAGU      \
                        GC  GAGG CA GGA GACUUGACU  GGUCA      U
CCAUGUAGAAAAACGAAACCCCGA^ U-    A  A   C         C-     UACAUU 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
To
Star sequence

Ami-Mir-24-P2_5p*

MirBase accessionMIMAT0038061
Sequence
0- GUGCCUACUGAGCUGAUAUCAGU -23
Get sequence
Mature sequence

Ami-Mir-24-P2_3p

MirBase accessionMIMAT0038062
Sequence
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence