MirGeneDB

MirGeneDB ID

Xtr-Mir-24-P2

Family name MIR-24 (all species)
Seed GGCUCAG
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-24a
Paralogues Xtr-Mir-24-P1 
Orthologues Aca-Mir-24-P2  Ami-Mir-24-P2  Bta-Mir-24-P2  Cfa-Mir-24-P2  Cpi-Mir-24-P2  Cpo-Mir-24-P2  Dno-Mir-24-P2  Dre-Mir-24-P2a  Dre-Mir-24-P2b  Ete-Mir-24-P2  Gga-Mir-24-P2  Hsa-Mir-24-P2  Mdo-Mir-24-P2  Mml-Mir-24-P2  Mmu-Mir-24-P2  Oan-Mir-24-P2  Ocu-Mir-24-P2  Rno-Mir-24-P2  Sha-Mir-24-P2  Sto-Mir-24-o2  Sto-Mir-24-P2  Tgu-Mir-24-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(xenTro7)
KB021649: 90034717-90034775 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-24-P2)
Mir-24-P2 KB021649: 90034717-90034775 [-] UCSC
Mir-27-P2 KB021649: 90035317-90035379 [-] UCSC
Mir-23-P2 KB021649: 90035547-90035606 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GUUCUACACCUACGAUGGACCUGUCCUCUUGUGCCUACUGAACUGAUAUCAGUUCUAUUUCACACACUGGCUCAGUUCAGCAGGAACAGGAGUCGGGCCCUUGAGCAAAGCGCAACUUU
Get precursor sequence
Structure
        10           20        30        40        50         
GUUCUACACCUACGAUGGA---|   UC       G   A         UA     UCUAU 
                      CCUG  CUCUUGU CCU CUGAACUGA  UCAGU     U
                      GGGC  GAGGACA GGA GACUUGACU  GGUCA     U
UUUCAACGCGAAACGAGUUCCC^   U-       A   C         C-     CACAC 
       110       100         90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Br Em Em Em Em He
Star sequence

Xtr-Mir-24-P2_5p*

MirBase accessionMIMAT0003653
Sequence
0- GUGCCUACUGAACUGAUAUCAGU -23
Get sequence
Validated targets TargetScanVert: xtr-miR-24a-5p
Mature sequence

Xtr-Mir-24-P2_3p

MirBase accessionMIMAT0003654
Sequence
37- UGGCUCAGUUCAGCAGGAACAG -59
Get sequence
Validated targets TargetScanVert: xtr-miR-24a-3p