MirGeneDB

MirGeneDB ID

Ocu-Mir-24-P2

Family name MIR-24 (all species)
Seed GGCUCAG
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID ocu-mir-24-1
Paralogues Ocu-Mir-24-P1 
Orthologues Aca-Mir-24-P2  Ami-Mir-24-P2  Bta-Mir-24-P2  Cfa-Mir-24-P2  Cpi-Mir-24-P2  Cpo-Mir-24-P2  Dno-Mir-24-P2  Dre-Mir-24-P2a  Dre-Mir-24-P2b  Ete-Mir-24-P2  Gga-Mir-24-P2  Hsa-Mir-24-P2  Mdo-Mir-24-P2  Mml-Mir-24-P2  Mmu-Mir-24-P2  Oan-Mir-24-P2  Rno-Mir-24-P2  Sha-Mir-24-P2  Sto-Mir-24-o2  Sto-Mir-24-P2  Tgu-Mir-24-P2  Xtr-Mir-24-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(oryCun2)
chr1: 74102787-74102846 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P2)
Mir-23-P2 chr1: 74102158-74102217 [+] UCSC Ensembl
Mir-27-P2 chr1: 74102379-74102441 [+] UCSC Ensembl
Mir-24-P2 chr1: 74102787-74102846 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUCCGGGCUGCCGAUUGGACCCGCCCUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCGUUUCACACACUGGCUCAGUUCAGCAGGAACAGGAGUGGAGCCCUCGAGCCAAAAGCCUCGCC
Get precursor sequence
Structure
        10        20          30        40        50          
CUCCGGGCUGCCGAUUGGACCCG-  -|   G  G   A         UA     UCUCGU 
                        CC CUCC GU CCU CUGAGCUGA  UCAGU      \
                        GG GAGG CA GGA GACUUGACU  GGUCA      U
CCGCUCCGAAAACCGAGCUCCCGA  U^   A  A   C         C-     CACACU 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentAlthough not well supported by deep read data all taxa sequenced in this study show the same read pattern and better more deeply sequenced vertebrate taxa are all clearly Group 2 miRNAs suggesting that this too is likely a Group 2 miRNA.
3' NTU Yes
MotifsNo
Tissue expression
 +
He Ki Te To Wh
Star sequence

Ocu-Mir-24-P2_5p*

MirBase accessionMIMAT0048130
Sequence
0- GUGCCUACUGAGCUGAUAUCAGU -23
Get sequence
Mature sequence

Ocu-Mir-24-P2_3p

MirBase accessionMIMAT0048131
Sequence
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence