MirGeneDB

MirGeneDB ID

Ocu-Mir-27-P2

Family name MIR-27 (all species)
Seed UCACAGU
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID ocu-mir-27b
Paralogues
Orthologues Aca-Mir-27-P2  Ami-Mir-27-P2  Bta-Mir-27-P2  Cfa-Mir-27-P2  Cli-Mir-27-P2  Cpi-Mir-27-P2  Cpo-Mir-27-P2  Dno-Mir-27-P2  Dre-Mir-27-P2a  Dre-Mir-27-P2b  Ete-Mir-27-P2  Gga-Mir-27-P2  Hsa-Mir-27-P2  Mdo-Mir-27-P2  Mml-Mir-27-P2  Mmu-Mir-27-P2  Oan-Mir-27-P2  Rno-Mir-27-P2  Sha-Mir-27-P2  Sto-Mir-27-P2  Tgu-Mir-27-P2  Xtr-Mir-27-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(oryCun2)
chr1: 74102379-74102441 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-27-P2)
Mir-23-P2 chr1: 74102158-74102217 [+] UCSC Ensembl
Mir-27-P2 chr1: 74102379-74102441 [+] UCSC Ensembl
Mir-24-P2 chr1: 74102787-74102846 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGCCCAGCGACGACCUCUCUGACGAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCCUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUGAGAUGGGCGCGGCC
Get precursor sequence
Structure
        10            20        30        40        50        60  
GGCCCAGCGACGACCUC----|  GACG                  AUUG       GUGAUUGG 
                     UCU    AGGUGCAGAGCUUAGCUG    GUGAACA        \
                     AGA    UCCACGUCUUGAAUCGGU    CACUUGU        U
CCGGCGCGGGUAGAGUGGAAG^  AG--                  GA--       UCCGCCUU 
 120       110       100          90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
He Ki Te To Wh
Star sequence

Ocu-Mir-27-P2_5p*

MirBase accessionMIMAT0048139
Sequence
0- AGAGCUUAGCUGAUUGGUGAACA -23
Get sequence
Mature sequence

Ocu-Mir-27-P2_3p

MirBase accessionMIMAT0048140
Sequence
42- UUCACAGUGGCUAAGUUCUGC -63
Get sequence