MirGeneDB

MirGeneDB ID

Tgu-Mir-27-P2

Family name MIR-27 (all species)
Seed UCACAGU
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-27
Paralogues Tgu-Mir-27-P1 
Orthologues Aca-Mir-27-P2  Ami-Mir-27-P2  Bta-Mir-27-P2  Cfa-Mir-27-P2  Cli-Mir-27-P2  Cpi-Mir-27-P2  Cpo-Mir-27-P2  Dno-Mir-27-P2  Dre-Mir-27-P2a  Dre-Mir-27-P2b  Ete-Mir-27-P2  Gga-Mir-27-P2  Hsa-Mir-27-P2  Mdo-Mir-27-P2  Mml-Mir-27-P2  Mmu-Mir-27-P2  Oan-Mir-27-P2  Ocu-Mir-27-P2  Rno-Mir-27-P2  Sha-Mir-27-P2  Sto-Mir-27-P2  Xtr-Mir-27-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(taeGut3.2.4)
Z: 9900334-9900396 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-27-P2)
Mir-24-P2 Z: 9899811-9899870 [-] UCSC Ensembl
Mir-27-P2 Z: 9900334-9900396 [-] UCSC Ensembl
Mir-23-P2 Z: 9900653-9900712 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUGAGACCGAGAUCUCUCUGGCGAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGUUUUCCUCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGGAGAGGAGACUCUCUG
Get precursor sequence
Structure
        10            20        30        40        50        60  
GCUGAGACCGAGAUCUC----|  GG G                  AUUG       GUGAUUGU 
                     UCU  C AGGUGCAGAGCUUAGCUG    GUGAACA        \
                     AGA  G UCCACGUCUUGAAUCGGU    CACUUGU        U
GUCUCUCAGAGGAGAGGGAAG^  A- -                  GA--       UUCUCCUU 
 120       110       100          90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Star sequence

Tgu-Mir-27-P2_5p*

MirBase accessionMIMAT0026991
Sequence
0- AGAGCUUAGCUGAUUGGUGAACA -23
Get sequence
Mature sequence

Tgu-Mir-27-P2_3p

MirBase accessionMIMAT0014534
Sequence
42- UUCACAGUGGCUAAGUUCUGC -63
Get sequence